ID: 995849316

View in Genome Browser
Species Human (GRCh38)
Location 5:116528387-116528409
Sequence ATTGTAAAGGCGAATGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995849316_995849320 27 Left 995849316 5:116528387-116528409 CCATCCTCATTCGCCTTTACAAT 0: 1
1: 0
2: 1
3: 9
4: 155
Right 995849320 5:116528437-116528459 ATTGTCAGGAGAGCCAGCTCAGG No data
995849316_995849319 13 Left 995849316 5:116528387-116528409 CCATCCTCATTCGCCTTTACAAT 0: 1
1: 0
2: 1
3: 9
4: 155
Right 995849319 5:116528423-116528445 TGCAGAAGCAGTTGATTGTCAGG 0: 1
1: 0
2: 2
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995849316 Original CRISPR ATTGTAAAGGCGAATGAGGA TGG (reversed) Intronic
903918072 1:26779086-26779108 ATTTTAAAGGAGTATGAGGTGGG + Exonic
905240858 1:36580667-36580689 ATTGGGAAGGACAATGAGGAGGG + Intergenic
906788340 1:48635893-48635915 GTTGTAATGGCAAATGAAGAAGG - Intronic
908518218 1:64915104-64915126 ATTGTGAAGGTAAATGAGGCAGG + Intronic
909169830 1:72281791-72281813 ATGGTATAAGAGAATGAGGAAGG + Intronic
910220177 1:84881738-84881760 ATTGGAAAGGGGGAAGAGGAGGG + Intronic
911182660 1:94875123-94875145 ATCGCAAAAGAGAATGAGGAAGG + Intronic
911226391 1:95310053-95310075 ATTGAAAAGGCTAATGGGCAGGG - Intergenic
911584059 1:99669810-99669832 ATTAAAAAGGAGAAGGAGGAGGG + Intronic
912534866 1:110359715-110359737 AATGTAAAGGAGAAAGAGTAGGG + Intergenic
914717990 1:150267540-150267562 ATTGTAACCGGGAATGGGGAGGG - Intronic
914765345 1:150632498-150632520 TTAGAAAAGGCGAATGAGGCTGG + Intergenic
915574411 1:156766263-156766285 ATTGGAAAGGTTGATGAGGAGGG - Intronic
916703948 1:167326952-167326974 TTCGTAAAGGCGGAAGAGGAGGG + Intronic
917150564 1:171939603-171939625 TTTCTAAATGGGAATGAGGAAGG - Intronic
917253957 1:173094586-173094608 ACTGTAAAGACTAAAGAGGATGG - Intergenic
920341640 1:205278843-205278865 AGTGAGAAGGAGAATGAGGATGG + Intergenic
921330457 1:214030534-214030556 TTTTTAAAGGGGATTGAGGAGGG + Intronic
1065929618 10:30468172-30468194 GCTGAAGAGGCGAATGAGGAAGG - Intergenic
1067451265 10:46383525-46383547 ATAATGAAGGCGTATGAGGAAGG + Intronic
1067585977 10:47476231-47476253 ATAATGAAGGCGTATGAGGAAGG - Exonic
1070972455 10:80578805-80578827 ATGGTCAAGGCCAATGAGCAAGG + Intronic
1071973435 10:90931147-90931169 TTTGGGAAGGCGGATGAGGAGGG - Intergenic
1074249503 10:111730561-111730583 ATTGTAAAGCTGTCTGAGGACGG + Intergenic
1078120853 11:8507537-8507559 GTGGTAAAGGTGAAGGAGGAAGG + Intronic
1079429358 11:20374119-20374141 ATGGGAAAGGAGGATGAGGAAGG + Intronic
1082996396 11:59259110-59259132 AGTGAAAGGGCCAATGAGGAGGG - Intergenic
1084879725 11:72162349-72162371 ATTGTAAATGGGCATGAGGGGGG + Intergenic
1086460732 11:87003103-87003125 CTTGTAAAGCCTTATGAGGAAGG + Intergenic
1089307062 11:117533258-117533280 GTTGTAAAAGCCAATGAGCAAGG - Intronic
1090114308 11:123951350-123951372 AATATAAATGCCAATGAGGAGGG + Intergenic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1091594107 12:1864276-1864298 ATTTTAAAGTCGAATGACAATGG + Intronic
1093474939 12:19544320-19544342 AATGGAAAGGGGAATGGGGAGGG - Intronic
1098056071 12:66506824-66506846 TATGTAAAAGGGAATGAGGAAGG + Intronic
1099336515 12:81366232-81366254 ACTTTAAAGGCTAATGAAGAAGG + Intronic
1100654576 12:96627855-96627877 AGTGTACAGGCAAATGTGGAGGG + Intronic
1100892093 12:99137009-99137031 CTTGGAAACGAGAATGAGGAAGG - Intronic
1104103092 12:125634157-125634179 TTTGGAAAGGCGAAGGAAGAGGG - Intronic
1104370804 12:128222322-128222344 ATTGTAAAGGGAACTAAGGATGG + Intergenic
1109020818 13:57090310-57090332 ATTGTAAAGGGGAAGGAGAATGG + Intergenic
1118012729 14:61626485-61626507 ACTCTAAAGTGGAATGAGGAAGG - Intronic
1118474913 14:66107700-66107722 ATTGCTGAGGCAAATGAGGAGGG + Intergenic
1118824316 14:69366672-69366694 ATTATAAAGGAGTATGAGGCAGG - Intergenic
1120598553 14:86472053-86472075 ATTGTAAAGACCATTGAGGCTGG - Intergenic
1123991594 15:25687566-25687588 ATTACACAGGCGAAGGAGGATGG + Intronic
1125466288 15:39956298-39956320 GTTATAAAGGGGAATGAGGCTGG - Intronic
1130961280 15:88660061-88660083 ATGGAATAGGAGAATGAGGAGGG - Intergenic
1131366352 15:91845354-91845376 AATGTAAGTGCGAATAAGGATGG - Intergenic
1138443189 16:57047251-57047273 ATGGTCAAGGTGAGTGAGGATGG + Intronic
1142314347 16:89334250-89334272 ATTGTGAAGGCCATTGATGAGGG - Intronic
1143603000 17:7961404-7961426 CTTGGAAAGGTAAATGAGGAAGG + Intergenic
1147943550 17:44066857-44066879 AATGAAAAGGGGAAAGAGGAGGG + Intronic
1148038135 17:44684226-44684248 ATTTTAAGAGAGAATGAGGAAGG - Intronic
1148244722 17:46023132-46023154 ATTGCAAAGGAAAATGTGGAAGG - Intronic
1149962676 17:61129316-61129338 AATGTAAAGGTGAATAATGATGG - Intronic
1150576383 17:66434290-66434312 ATTGTAAAGTCTAATGAAGACGG - Intronic
1150888192 17:69112014-69112036 ATTGTAAAGACACAGGAGGAAGG + Intronic
1150987167 17:70212041-70212063 ATTATAAAGGCGTTTGAAGAAGG - Intergenic
1152274140 17:79344475-79344497 ATTGAGAAGCCCAATGAGGAAGG - Intronic
1153957629 18:10111671-10111693 ATTGGAAAGGCAAACAAGGAGGG + Intergenic
1155904201 18:31429608-31429630 AGTGAAAAGGCAAAGGAGGAAGG + Intergenic
1157466356 18:47949658-47949680 ATTTTAAAGGCAAATGGGGGAGG + Intergenic
1157631883 18:49106494-49106516 ATTGTAAAGACCATTGAGGCTGG - Intronic
1158176955 18:54668268-54668290 ATTGTAAAGACCATTGAGGCTGG - Intergenic
1159317014 18:66788525-66788547 TTTTAAAAGGGGAATGAGGAAGG - Intergenic
1160772192 19:837455-837477 CCTGTAAAGGCGGGTGAGGACGG - Intergenic
925443045 2:3905003-3905025 ATTGTAACTGAGAAAGAGGAAGG - Intergenic
928615207 2:33031558-33031580 ATTCTAATGGCGAGTAAGGAAGG + Intronic
929191353 2:39143198-39143220 ATTGGAAAGGGGCATAAGGAGGG - Intergenic
930451325 2:51541564-51541586 ACTGTAAAAGCAAATGAGGAAGG - Intergenic
930559719 2:52945890-52945912 ATTTTAAAGGCAAACAAGGAAGG - Intergenic
931252754 2:60548997-60549019 ATTGTTGGGGCGAAGGAGGATGG - Intronic
935705065 2:105849454-105849476 AGTGGAAAGGTGAATGAGGCAGG + Intronic
936632557 2:114219448-114219470 ATTGTAAAGAGGAATCATGAAGG + Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
941327653 2:164136704-164136726 ATTAGAAAGGTAAATGAGGATGG + Intergenic
942790516 2:179756021-179756043 ATTGTAAAGACCACTGAGGCTGG - Intronic
943038664 2:182777088-182777110 AATGTAAAGGCGATAGAGAAAGG - Intronic
945814979 2:214593701-214593723 TTTTAAAAGGAGAATGAGGAAGG + Intergenic
948095338 2:235328994-235329016 ATTGAGAAGGGGATTGAGGAGGG + Intergenic
1171426947 20:25054940-25054962 GTTGTAAAGGTGAAAGTGGAAGG - Intronic
1173607142 20:44339472-44339494 ACTGTTAAGGAGGATGAGGAGGG + Intronic
1174980475 20:55388719-55388741 TTTATAAAGGAGAATCAGGACGG - Intergenic
1175654012 20:60753105-60753127 TTTGAAAAGGAGAAGGAGGAAGG - Intergenic
1176049674 20:63111349-63111371 TTTGTGAAGGCCACTGAGGATGG - Intergenic
1179606205 21:42517092-42517114 ATTGTAAATTCAAAAGAGGAAGG - Intronic
1184297703 22:43535744-43535766 GTTGTTGAGGCAAATGAGGAAGG + Intronic
1184901355 22:47448425-47448447 ATTGTTCAGGTGAATGAGGTAGG - Intergenic
952204541 3:31167410-31167432 ATAGTAGAGGTGAAGGAGGAAGG - Intergenic
953309464 3:41863181-41863203 TTTGGAAAGGGGAAGGAGGAAGG - Intronic
956421217 3:69087669-69087691 ATTTGAAAGGAAAATGAGGAGGG - Intronic
959044538 3:101458100-101458122 ATTGTCAAGGTGAATAAGGCAGG - Intronic
959764461 3:110008907-110008929 ATTGTAAAAGAGAGTTAGGAAGG - Intergenic
959877480 3:111402042-111402064 ATTGTAAAGGCCAAGGAAGAAGG - Intronic
967507200 3:190266016-190266038 ATAGAAAAGGGGAAGGAGGAGGG + Intergenic
967711997 3:192719980-192720002 ATTGTAGAAGTGAATGAGGTAGG + Intronic
967828441 3:193897766-193897788 GTTGTGAAGGCCAAAGAGGATGG + Intergenic
970432653 4:16002918-16002940 ATTGAAAAGGAGGAAGAGGAGGG + Intronic
970636387 4:18014117-18014139 ATTTTAAAGGCGACTGAGGATGG + Intronic
973367449 4:49219135-49219157 ATTGTAATGGGGAATGTTGAAGG - Intergenic
974003288 4:56531457-56531479 ACTGTAGAGGCGAATGAAGAAGG - Intronic
975581861 4:75914223-75914245 GTTGTAAAGTTAAATGAGGAAGG + Exonic
976755757 4:88496350-88496372 ATTCTTAAGGCAAATAAGGATGG + Intronic
978596258 4:110380132-110380154 CTGGTATGGGCGAATGAGGATGG + Intronic
983372135 4:166873848-166873870 ATTCTAAAGGAAAAAGAGGAAGG + Intronic
983783768 4:171706084-171706106 ATTTTAAGGGCACATGAGGATGG - Intergenic
987453278 5:18112606-18112628 ATTGGAAAGGAGAATGACAATGG - Intergenic
990469244 5:56098560-56098582 ATTGTAAAGGAGAAAGTGTACGG - Intergenic
992504044 5:77367974-77367996 ATTGTCAGGGCCAATGAGGCTGG + Intronic
993362223 5:86991677-86991699 ACTGGAAAGGAGAATGATGAGGG - Intergenic
995041994 5:107599276-107599298 GTTGTAAAGAATAATGAGGAAGG + Intronic
995849316 5:116528387-116528409 ATTGTAAAGGCGAATGAGGATGG - Intronic
995896300 5:117015169-117015191 ATTGAATAGACTAATGAGGAAGG - Intergenic
996769113 5:127066952-127066974 ATTGTCAAGGAGACTGATGAGGG + Intronic
997074988 5:130663579-130663601 ATTGTAAAGGTGAATGGGTAAGG - Intergenic
997861484 5:137421886-137421908 ATTGTAAAGACCATTGAGGCTGG - Intronic
998394727 5:141811468-141811490 AATGAAAAGGGGAATGAGGAAGG - Intergenic
1002692724 5:181061663-181061685 TTTGAAAGGGGGAATGAGGAAGG + Intergenic
1005033021 6:21529082-21529104 ATTGAAAAGGAGAAAGAAGAAGG - Intergenic
1008550344 6:52623681-52623703 ACTGAAAAGGGGAATGAGAAAGG - Intergenic
1008859489 6:56132411-56132433 ATTATAAAGAATAATGAGGAAGG + Intronic
1009157771 6:60244205-60244227 ATATTAAAGGTGAATGAGTAAGG + Intergenic
1010380910 6:75223985-75224007 ATTCTAAAGGACAATGAAGATGG + Intergenic
1012299449 6:97566589-97566611 ATTCTAAAGTCCAATGAGGCAGG - Intergenic
1013899317 6:115133956-115133978 CTTGTCAAGGAGAATGATGATGG - Intergenic
1016907520 6:149166562-149166584 ATAGTAAATGGGAATGAGGCTGG + Intergenic
1017038412 6:150287702-150287724 ATTATAAAGGCTCTTGAGGATGG + Intergenic
1017473424 6:154763157-154763179 AATGAAAAGCAGAATGAGGAGGG - Intronic
1017626922 6:156358399-156358421 ATTTTAAAGGGGAAAAAGGAGGG + Intergenic
1022576308 7:31500531-31500553 ATTGAAAAGTGGAATGTGGAAGG - Intergenic
1022685389 7:32591505-32591527 ACTGTGAAGGCCAGTGAGGAAGG - Intergenic
1025125562 7:56341700-56341722 ACTGTAAAGGGGAATGAAGGAGG - Intergenic
1032494584 7:132351613-132351635 ATTGTAATGGAGAAGGTGGATGG - Intronic
1033584556 7:142764457-142764479 ATTTTCCAGGTGAATGAGGAGGG - Intergenic
1033586036 7:142775012-142775034 ATTTTCCAGGCGAATGAGAAGGG - Intergenic
1035536473 8:395070-395092 CTGGTGAAGGGGAATGAGGAAGG + Intergenic
1038395567 8:27243226-27243248 ATTGTACAAGCAAATGAGGATGG - Intronic
1039476208 8:37840647-37840669 AATTTAAAGGGGAAAGAGGATGG + Intronic
1041158096 8:55008761-55008783 CTTGTAAGGGAGAAAGAGGAAGG - Intergenic
1044138341 8:88616037-88616059 ATTGGAAAGGCATATGAGGGGGG - Intergenic
1044740850 8:95324663-95324685 ATTGTAAAGGGGAAAGAGGGAGG - Intergenic
1046595988 8:116261729-116261751 ACTGCAAAGGAGACTGAGGAAGG + Intergenic
1046796081 8:118373701-118373723 ATTATGAAGGCATATGAGGATGG + Intronic
1046801053 8:118427427-118427449 ACTGTAAAGGGGAATGAAGGAGG - Intronic
1047175590 8:122537648-122537670 CTTGGAAAGGTGAATGAGGGAGG + Intergenic
1047185382 8:122628363-122628385 ATTGCAAAGGCAAATGGGGGAGG + Intergenic
1048362031 8:133705775-133705797 ATTGGAAAGGCTGGTGAGGAGGG + Intergenic
1049033831 8:140059103-140059125 GTTGTAAAGGGGCAGGAGGAAGG - Intronic
1051198637 9:14592335-14592357 ATTTTAAAAGAGAAAGAGGAAGG - Intergenic
1051728891 9:20117718-20117740 ATTGTAAAGGGGAAATAGTATGG - Intergenic
1054959049 9:70946701-70946723 ACTGGAAAGGAGGATGAGGAGGG - Intronic
1059062656 9:111049855-111049877 ATTTTAAATGCAAATGAGGCAGG + Intergenic
1185747101 X:2582569-2582591 ATTTTAATGGAGAATGTGGAGGG + Intergenic
1186388106 X:9130536-9130558 ATTTTAAAGGAACATGAGGAAGG + Intronic
1188321276 X:28740301-28740323 ATTTTAAGTGAGAATGAGGAAGG + Intronic
1193295312 X:79826230-79826252 AGTGTACTGGTGAATGAGGATGG - Intergenic
1195004823 X:100675530-100675552 ATTGGAGAGGAGAAAGAGGAAGG + Exonic
1196175006 X:112630820-112630842 ATTCTAAAGCATAATGAGGAAGG + Exonic
1197288335 X:124623727-124623749 TTTTTAAAGGGCAATGAGGAAGG - Intronic
1199800801 X:151248726-151248748 ATTGTGAAGGTGAATTAGGGAGG + Intergenic
1202164753 Y:21975490-21975512 AGTGCAAAGGGGAACGAGGAAGG - Intergenic
1202226603 Y:22610884-22610906 AGTGCAAAGGGGAACGAGGAAGG + Intergenic
1202316516 Y:23584778-23584800 AGTGCAAAGGGGAACGAGGAAGG - Intergenic
1202554248 Y:26085280-26085302 AGTGCAAAGGGGAACGAGGAAGG + Intergenic
1202590539 Y:26478767-26478789 ATTGTAAAGGAGACAGAGTATGG - Intergenic