ID: 995849606

View in Genome Browser
Species Human (GRCh38)
Location 5:116531557-116531579
Sequence TGGGAATCACTATATCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 89}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995849606_995849611 3 Left 995849606 5:116531557-116531579 CCTGTTAGATATAGTGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 995849611 5:116531583-116531605 TTCTCTTCAAAGAATACTTGGGG 0: 1
1: 0
2: 1
3: 28
4: 325
995849606_995849610 2 Left 995849606 5:116531557-116531579 CCTGTTAGATATAGTGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 995849610 5:116531582-116531604 TTTCTCTTCAAAGAATACTTGGG No data
995849606_995849616 11 Left 995849606 5:116531557-116531579 CCTGTTAGATATAGTGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 995849616 5:116531591-116531613 AAAGAATACTTGGGGGAAGGGGG 0: 1
1: 0
2: 3
3: 41
4: 444
995849606_995849614 9 Left 995849606 5:116531557-116531579 CCTGTTAGATATAGTGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 995849614 5:116531589-116531611 TCAAAGAATACTTGGGGGAAGGG No data
995849606_995849609 1 Left 995849606 5:116531557-116531579 CCTGTTAGATATAGTGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 995849609 5:116531581-116531603 GTTTCTCTTCAAAGAATACTTGG 0: 1
1: 0
2: 1
3: 24
4: 245
995849606_995849612 4 Left 995849606 5:116531557-116531579 CCTGTTAGATATAGTGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 995849612 5:116531584-116531606 TCTCTTCAAAGAATACTTGGGGG 0: 1
1: 0
2: 2
3: 23
4: 238
995849606_995849613 8 Left 995849606 5:116531557-116531579 CCTGTTAGATATAGTGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 995849613 5:116531588-116531610 TTCAAAGAATACTTGGGGGAAGG 0: 1
1: 0
2: 2
3: 31
4: 296
995849606_995849615 10 Left 995849606 5:116531557-116531579 CCTGTTAGATATAGTGATTCCCA 0: 1
1: 0
2: 0
3: 8
4: 89
Right 995849615 5:116531590-116531612 CAAAGAATACTTGGGGGAAGGGG 0: 1
1: 0
2: 1
3: 38
4: 429

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995849606 Original CRISPR TGGGAATCACTATATCTAAC AGG (reversed) Intronic
901949872 1:12735151-12735173 TGGGGATCATCATATCTAATGGG + Intergenic
904109275 1:28112722-28112744 CGGGAATCTGTATTTCTAACAGG + Intergenic
904377897 1:30093395-30093417 TGGGGTTCACTATATTTAACAGG + Intergenic
909252633 1:73378574-73378596 TTTGAATAACTATATCTAATTGG + Intergenic
911820641 1:102415569-102415591 TGTGAAATACTATATCTAATTGG - Intergenic
919203096 1:194384545-194384567 TATGATTCCCTATATCTAACTGG + Intergenic
921881826 1:220263831-220263853 TGGGAATCACTGAGTCTTACAGG + Intronic
923323250 1:232857394-232857416 CAGGCATCACTATATCTCACTGG + Intergenic
1064381732 10:14848683-14848705 TGGTAATTACTCTATGTAACAGG - Intronic
1068188994 10:53625480-53625502 TTGGAATCATTTTATCTAAGGGG + Intergenic
1068509871 10:57951840-57951862 TGGGAAGAACTATAGCTCACGGG - Intergenic
1073583139 10:104685685-104685707 TGGAAATCACTATACAGAACGGG - Intronic
1073904948 10:108267714-108267736 AGGAAATCAGTATATCTAAGAGG - Intergenic
1075271086 10:121051502-121051524 GGGTAATCACTACCTCTAACTGG - Intergenic
1077519229 11:3021681-3021703 TGGGAATCAGTATACCAAAATGG - Intronic
1077531492 11:3098143-3098165 TGGGAAACAATATATCAAAATGG + Intronic
1080633060 11:34097470-34097492 TGGAAATCACTGTCTTTAACAGG - Intronic
1085874579 11:80390914-80390936 TGGCAAACACTCTATCAAACTGG + Intergenic
1086270903 11:85065447-85065469 GGGAAATCATTATACCTAACTGG - Intronic
1088399405 11:109406790-109406812 TGGGAATCATTATAACTCCCTGG - Intergenic
1089757659 11:120698274-120698296 TGGGCATCACTACACATAACAGG + Intronic
1090732154 11:129581314-129581336 TTGGAATCACTAGATTAAACAGG - Intergenic
1091216887 11:133907587-133907609 TGGGCAGCACCATATCTTACCGG + Intergenic
1093007835 12:14069913-14069935 TGGGAAGCATTATATATTACAGG - Intergenic
1094764186 12:33573377-33573399 TGGGAATTAGTGTATCTAATTGG + Intergenic
1102919319 12:116779941-116779963 TGGCAATCACTATGTCCTACAGG - Intronic
1107379236 13:39837873-39837895 AGGAAATCACTATATCAAAGAGG - Intergenic
1120359636 14:83481934-83481956 TGGTAAGCCCTATATCTAACTGG - Intergenic
1123847184 15:24314592-24314614 TGGGAATAACTGGATCTCACAGG - Intergenic
1123866182 15:24521659-24521681 TGGGAATAACTGGATCTCACAGG - Intergenic
1126504627 15:49390388-49390410 TGTGGATCCCTATATCAAACAGG - Intronic
1129150123 15:73683517-73683539 TGGGAATAATAATATCTAGCCGG + Intergenic
1129605741 15:77024194-77024216 TGAGAATCTGTATTTCTAACAGG + Intronic
1139262392 16:65607205-65607227 TGGGCAACACTAGAACTAACCGG + Intergenic
1142547202 17:713354-713376 TAGAAATCACTATTTCTGACCGG + Intronic
1147510327 17:41063303-41063325 TGGACATCACTGTATCGAACAGG - Intergenic
1153125215 18:1783469-1783491 TGGGAACATGTATATCTAACGGG - Intergenic
1153169790 18:2302841-2302863 TGGAGTTCACTATATCTAACAGG - Intergenic
1155934238 18:31738848-31738870 TGGAGTTCACTATATTTAACAGG - Intergenic
1157521250 18:48347091-48347113 TGGGAATCACTCTATAGAAAAGG - Intronic
1158066423 18:53414847-53414869 TGGGAAACACTACATATACCAGG - Intronic
1162042930 19:7981249-7981271 CGGGAAGCACTATATCTGCCTGG + Intronic
1164086702 19:21909181-21909203 TGGGAATTGCTATATATGACTGG + Intergenic
1165556311 19:36635671-36635693 AGGAAATCAGTATATCTAAGAGG - Intergenic
928483341 2:31705824-31705846 TGGGAATCTGAATATTTAACTGG + Intergenic
930307945 2:49700042-49700064 TGGAAATTACAATATCTAAAGGG - Intergenic
932945265 2:76222231-76222253 TCAGAATGACTATATCTAACAGG - Intergenic
937411844 2:121683432-121683454 TAGGGTTCACTATATTTAACAGG + Intergenic
937858128 2:126687390-126687412 TGAGAATTTCTATTTCTAACAGG + Intronic
938568683 2:132542853-132542875 TGGGAAGCACCAACTCTAACTGG - Intronic
941004029 2:160229068-160229090 TGTGAATCACTAAATCTTGCTGG - Intronic
942211012 2:173670235-173670257 TGGGTATCACTTTATCTAATGGG - Intergenic
943495582 2:188616836-188616858 AGGGCATCACTCTATCAAACTGG + Intergenic
1169988303 20:11471481-11471503 TGTTAATCACTATTTCTAATTGG + Intergenic
1173247531 20:41346911-41346933 TGGGAAATAGTATATCTAAGAGG + Intronic
1174339257 20:49885901-49885923 TGGGAATCTGCAGATCTAACAGG - Intronic
1177185946 21:17796456-17796478 TGGGAAACATTGTATTTAACAGG - Intronic
949841190 3:8321852-8321874 TGGGAATCTGTATTTCTAACAGG - Intergenic
953259823 3:41326980-41327002 TAGGAATAACTATATAAAACAGG + Intronic
958766372 3:98372786-98372808 TTGGAAACAGAATATCTAACAGG - Intergenic
974175583 4:58317857-58317879 TAGGACTCACTGTATCTATCAGG - Intergenic
975507252 4:75151149-75151171 TGAAAATCACTATATCAAAGAGG - Intergenic
976158072 4:82169152-82169174 AGGGCATCAGTATATCAAACAGG + Intergenic
976783768 4:88792458-88792480 TGGGAACCACTATGAATAACAGG - Intronic
981144732 4:141311314-141311336 AGGGAATCAGTATTTTTAACAGG - Intergenic
981662171 4:147180663-147180685 TTGGAATCACTTTATATAGCAGG + Intergenic
984609887 4:181826130-181826152 TAGGAATAAATATATGTAACTGG - Intergenic
990950213 5:61291243-61291265 TGGGGTTCACTGTATCTTACTGG + Intergenic
991148701 5:63339625-63339647 TTAGATTCACTATATCTAAATGG - Intergenic
995849606 5:116531557-116531579 TGGGAATCACTATATCTAACAGG - Intronic
997363069 5:133307542-133307564 TGGGTATCACTTTATACAACTGG + Intronic
998297143 5:140982189-140982211 TGGCGCTCACTAAATCTAACAGG - Intronic
1000639176 5:163680714-163680736 TGGTAAACAATATATCAAACAGG + Intergenic
1005594493 6:27366409-27366431 TGGGAATCAGAATTTCTATCTGG - Intergenic
1007104181 6:39272240-39272262 TTGGACTCACTATAATTAACTGG + Intergenic
1011424712 6:87213836-87213858 TGGGGTTCACTATATTTAACAGG + Intronic
1011513338 6:88125575-88125597 TGGAGTTCACTATATTTAACAGG + Intergenic
1014546026 6:122736567-122736589 TAGGATTCACTCTATCTCACAGG - Intergenic
1022272533 7:28823655-28823677 AGGGAATCAGTAACTCTAACTGG + Exonic
1028215496 7:88127142-88127164 TGGTAATTATTTTATCTAACTGG - Intronic
1028707149 7:93862956-93862978 TGGGAATCACAGGCTCTAACTGG - Intronic
1032992610 7:137410565-137410587 GGGAAATCACTATATCCAGCTGG - Intronic
1034095037 7:148399973-148399995 TGGGCATCTGTATTTCTAACAGG - Intronic
1035199409 7:157251011-157251033 TGGGAATCTCTATGAATAACTGG - Intronic
1037109808 8:15152850-15152872 TGGGAATCACTATAGCAGTCAGG - Intronic
1038551258 8:28471061-28471083 AGGGAATCACCTTTTCTAACAGG + Intronic
1041835936 8:62215343-62215365 TGGGAATTAATATCTCTAAACGG - Intergenic
1046069875 8:109237667-109237689 TGTGAATCACTGTTTCTAAATGG + Intergenic
1047575044 8:126143559-126143581 TGGAGTTCACTATATTTAACAGG + Intergenic
1050232777 9:3545857-3545879 TGGAAATCACTTTACCTCACCGG + Intergenic
1051834025 9:21314443-21314465 AGGAAATCATTATATCTAAGAGG + Intergenic
1052195642 9:25710630-25710652 TGGGTTCCACTATATCTAGCTGG + Intergenic
1052357697 9:27522368-27522390 TTTGAGTCACTATCTCTAACTGG - Intronic
1055158735 9:73097626-73097648 TGGAAATCTGTCTATCTAACTGG - Intergenic
1062726860 9:138079122-138079144 TGGGAATCTGTATGTCTAACAGG - Intronic
1192070127 X:67930012-67930034 AGGAAATCAGTATATCTAAGGGG + Intergenic
1194236764 X:91394294-91394316 TGGGAATCCCAATATCAAAGGGG + Intergenic
1195481360 X:105349277-105349299 AGGAAATCACAATTTCTAACTGG - Intronic