ID: 995851643

View in Genome Browser
Species Human (GRCh38)
Location 5:116552590-116552612
Sequence AAGCGGCCCGGGCAGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 42}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995851635_995851643 21 Left 995851635 5:116552546-116552568 CCATCCTTCAGCATAGCTACACA 0: 1
1: 0
2: 0
3: 8
4: 139
Right 995851643 5:116552590-116552612 AAGCGGCCCGGGCAGTATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 42
995851639_995851643 -5 Left 995851639 5:116552572-116552594 CCATGGAGCAATTTAGTTAAGCG 0: 1
1: 0
2: 0
3: 2
4: 42
Right 995851643 5:116552590-116552612 AAGCGGCCCGGGCAGTATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 42
995851637_995851643 17 Left 995851637 5:116552550-116552572 CCTTCAGCATAGCTACACAAGGC 0: 1
1: 0
2: 1
3: 7
4: 83
Right 995851643 5:116552590-116552612 AAGCGGCCCGGGCAGTATGAAGG 0: 1
1: 0
2: 0
3: 4
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995851643 Original CRISPR AAGCGGCCCGGGCAGTATGA AGG Intronic
900501017 1:3004683-3004705 CAACAGCCCTGGCAGTATGACGG - Intergenic
906771662 1:48490436-48490458 CAGGGGCCCTGGCAGTATGAGGG + Intergenic
912814680 1:112819610-112819632 AAGATGCCCTGGCAGGATGACGG + Intergenic
921939421 1:220824652-220824674 AAGCTGCCCTGGCAGTTTTAGGG - Intergenic
923752827 1:236762252-236762274 AAGCGGCCTGGCCAGCAGGAAGG - Intronic
1067062829 10:43086783-43086805 CAGCGGCCTGGCCAGGATGATGG - Intronic
1073428296 10:103469728-103469750 CAGCTGCCCAGGCAGCATGAGGG + Intergenic
1076611604 10:131729431-131729453 AAGAGGCCAGGGCAGTGGGATGG - Intergenic
1083933393 11:65857979-65858001 CAGCGCCCCGGGCGGGATGAGGG - Intronic
1092763899 12:11835465-11835487 AAGCTGCATGGGCAGAATGAGGG - Intronic
1105024776 12:132840645-132840667 GAAGGGCCCGGGCAGCATGAGGG + Intronic
1105578026 13:21670981-21671003 GAGCGGCGCGGGCAGTAAGCCGG + Intergenic
1106660120 13:31790808-31790830 AAGCAGCCCTGGCAGTATCCAGG + Intronic
1128788693 15:70416741-70416763 AAGGGGCCAGGGGAGAATGATGG + Intergenic
1136061241 16:27728140-27728162 TGGGGGCCCGGGAAGTATGACGG + Intronic
1136232426 16:28894524-28894546 GTCCGGCCAGGGCAGTATGACGG + Exonic
1142122458 16:88393597-88393619 GAGCTGCCCGGGCAGGAGGAGGG + Intergenic
1147789195 17:43002620-43002642 TAGGGGCCCCGGCAGTATGTGGG + Intronic
1152570252 17:81118530-81118552 AAGGGGCCCGGCCTGTATGTGGG - Intronic
1157240571 18:46005980-46006002 AGGGTGCCCGGGCAGTATGAAGG + Intronic
1157406250 18:47424662-47424684 AAGTGGCCAGGGCAGTTTGGGGG + Intergenic
1160904270 19:1445229-1445251 ATGCGGCCCGGGCAGGATGGGGG - Intergenic
1161408130 19:4101754-4101776 AAGCAGCACAGGCAGTGTGACGG + Intronic
947623301 2:231604499-231604521 AGGCGGCCCGGCCAGCCTGAGGG + Intergenic
1170746138 20:19100513-19100535 AAGAGGCCAGGGCAGTGTGTAGG - Intergenic
1173277187 20:41595450-41595472 AAGCGGCCCAAGAAGGATGAAGG + Intronic
1173332183 20:42084712-42084734 AAGTGGCAGGAGCAGTATGACGG - Exonic
1174843839 20:53924161-53924183 AAGCAGCGGGGTCAGTATGAGGG - Intergenic
1175725293 20:61313930-61313952 AAGCAGCCTGGGCAACATGATGG - Intronic
1179990651 21:44946801-44946823 AAGAGCCCCGGGCTGGATGAAGG + Intronic
1180831000 22:18906093-18906115 AAGTGGCCCGGGGAGCAGGAAGG + Intronic
1181689054 22:24548217-24548239 AAGCAGCCTGGGCAGTGTGTGGG - Intronic
1203281087 22_KI270734v1_random:131364-131386 AAGTGGCCCGGGGAGCAGGAAGG + Intergenic
961340560 3:126214203-126214225 CAGAGGCCCGGGCAGTAAGCAGG - Intergenic
978499689 4:109395856-109395878 CAGCGGGCAGGACAGTATGACGG + Intergenic
983966991 4:173824424-173824446 AAGAGGACAGGGCAGTAGGATGG + Intergenic
987132611 5:14872402-14872424 TAGCGGCCCGGGAGGTATGGAGG + Intergenic
988526374 5:31990850-31990872 AAGCTGGCCGGGCAGTGTCATGG + Intronic
995851643 5:116552590-116552612 AAGCGGCCCGGGCAGTATGAAGG + Intronic
1017031951 6:150231440-150231462 AACCGGCCCAGGAACTATGAAGG - Intronic
1017519655 6:155190517-155190539 AAGAGGACCAGGCAGTATGAGGG + Intronic
1026257742 7:68727060-68727082 AAGGGCCCCAGGAAGTATGAAGG - Intergenic
1038162165 8:25050092-25050114 AAGCTTCCCTGGCAGTTTGAGGG - Intergenic
1057146811 9:92764355-92764377 AGGGGGCACGGGCAGTATGTGGG - Intronic
1059756918 9:117302511-117302533 AAGGGGCCCTGGCATTATAAGGG - Intronic
1061177210 9:129004938-129004960 AAGTGGCCAGGGGAGCATGAGGG + Intronic
1197679056 X:129362978-129363000 AAGCTGCCTGGGTAGCATGAAGG - Intergenic