ID: 995852345

View in Genome Browser
Species Human (GRCh38)
Location 5:116559469-116559491
Sequence GCCCCAAGTGCGGATGGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 3, 2: 13, 3: 32, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995852345_995852350 -8 Left 995852345 5:116559469-116559491 CCTGCCCCATCCGCACTTGGGGC 0: 1
1: 3
2: 13
3: 32
4: 172
Right 995852350 5:116559484-116559506 CTTGGGGCTGACGCCGTTTTAGG 0: 2
1: 11
2: 47
3: 49
4: 81
995852345_995852352 7 Left 995852345 5:116559469-116559491 CCTGCCCCATCCGCACTTGGGGC 0: 1
1: 3
2: 13
3: 32
4: 172
Right 995852352 5:116559499-116559521 GTTTTAGGCCTCAGCCCGCCTGG 0: 1
1: 0
2: 0
3: 2
4: 43
995852345_995852353 8 Left 995852345 5:116559469-116559491 CCTGCCCCATCCGCACTTGGGGC 0: 1
1: 3
2: 13
3: 32
4: 172
Right 995852353 5:116559500-116559522 TTTTAGGCCTCAGCCCGCCTGGG 0: 1
1: 0
2: 0
3: 10
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995852345 Original CRISPR GCCCCAAGTGCGGATGGGGC AGG (reversed) Intronic
900399293 1:2466476-2466498 GCCCCAGGTGTGGAGGGGGAGGG - Intronic
900654827 1:3751359-3751381 CCCACAGGTGTGGATGGGGCAGG + Intergenic
902387363 1:16083493-16083515 GCCCCAGGAGGGGCTGGGGCTGG + Intergenic
903233498 1:21935883-21935905 GCCCAGAGTGGGGATGGGGGAGG + Intronic
905793457 1:40802447-40802469 GCCCCGAGAGCGGGAGGGGCCGG - Intronic
907304979 1:53508386-53508408 GCCCCAAGGGCCTCTGGGGCGGG + Intronic
907662856 1:56409247-56409269 GCCCCACCTGCTGATGGGGCTGG - Intergenic
918371987 1:183870165-183870187 GCCCCAAGTGAGGACGGGACAGG + Intronic
919739554 1:200973676-200973698 TCCCCAAATGTGGTTGGGGCTGG + Intronic
919933908 1:202239006-202239028 GCCCCAAGTGAGGACGGGGCAGG + Intronic
920048920 1:203151620-203151642 GCCCCCTGTGAGGATGAGGCTGG - Intronic
921369234 1:214404634-214404656 GCCCCAGGTGCAGATGGAGGCGG - Intronic
922065434 1:222134577-222134599 GCAACAAGTGCTGATGGGGACGG - Intergenic
924719320 1:246607564-246607586 GCCCCACGTGAGGACCGGGCAGG + Intronic
924722207 1:246634841-246634863 GCGCCACGTGAGGACGGGGCAGG + Intronic
924795693 1:247290715-247290737 GCACCAAGTGAGGACAGGGCAGG - Intergenic
1065190246 10:23201202-23201224 GCCCCAAGGGCGGCTGGGGGTGG + Intergenic
1065867837 10:29928981-29929003 GCACCAAATGAGGATGGGGCAGG + Intergenic
1067080499 10:43209763-43209785 ACCCCAAGTCCAGCTGGGGCTGG + Intronic
1067767389 10:49097270-49097292 GCCCCCGGTGGGCATGGGGCAGG - Intronic
1073136953 10:101225485-101225507 GCCCCAAGGCCGGCTGGGGCGGG - Intergenic
1074851002 10:117439675-117439697 GCCCAAAGAGCAGATGGAGCAGG + Intergenic
1076066033 10:127448480-127448502 GCCCGACATGAGGATGGGGCTGG - Intronic
1076499288 10:130923699-130923721 CCCCCAAGGGTGGATGGGGAAGG - Intergenic
1076904589 10:133355694-133355716 GGCCCCAGTGGGGATGGGGCAGG + Intronic
1077099993 11:818468-818490 GCCCCCAGTAGGGCTGGGGCAGG + Intergenic
1078003641 11:7516624-7516646 GCACCAAGTGAGGACGAGGCAGG + Intronic
1078563112 11:12390288-12390310 GCCCCTGGTGGGGATGGGGAAGG + Intronic
1078932197 11:15921202-15921224 CCCTCGAGGGCGGATGGGGCAGG + Intergenic
1079130804 11:17745837-17745859 GCACGAAGTGGGGAAGGGGCCGG - Intronic
1079318668 11:19431551-19431573 GGCCAAAGTGAGGTTGGGGCTGG + Intronic
1081011045 11:37812540-37812562 GCCCAAAGTCCGGAGGGGGCTGG + Intergenic
1081600229 11:44487799-44487821 GCCCCGAGTGTGGATGGAGATGG - Intergenic
1082864442 11:57885832-57885854 GCCCCTAGTGTTAATGGGGCTGG + Intergenic
1083063562 11:59899632-59899654 GCCCTAAGTGAAGACGGGGCAGG + Intergenic
1083952923 11:65966708-65966730 GCACCAGGTGTGGATGGGTCAGG + Intronic
1085053733 11:73392514-73392536 CCCCCAAGTGGAGCTGGGGCTGG - Intronic
1085279406 11:75320257-75320279 GCCCAAGGTGGGGAGGGGGCTGG + Intronic
1087036203 11:93758679-93758701 GCCCCAAATCCAGAAGGGGCCGG - Intronic
1087048176 11:93861869-93861891 CCCCAAAGTGAGGATGGGGCAGG + Intergenic
1087049385 11:93869962-93869984 GCCCCAAGTGAGGATGAGGCAGG + Intergenic
1089378692 11:118012677-118012699 GCCCAGATTGGGGATGGGGCAGG + Intergenic
1090455066 11:126842007-126842029 GCACCAGGTGAGGATGGGGTAGG + Intronic
1094548876 12:31430763-31430785 GCCCCCAGTACATATGGGGCAGG + Intronic
1095215135 12:39538941-39538963 GCCCCAAGTGAGTATGGGACAGG - Intergenic
1100089056 12:90947873-90947895 GCCCCAAGTGAGGACAGGACAGG - Intronic
1100299024 12:93290319-93290341 GCACCAAGTGAGGATGGGGCAGG + Intergenic
1100312704 12:93412260-93412282 GCCACAAGTGAGGATGGGGATGG - Intronic
1100482068 12:94988765-94988787 GCACCAAATGAGGATGGGGCAGG - Intronic
1102026241 12:109715504-109715526 GACCCAAGGCCGGAGGGGGCGGG + Intronic
1102381235 12:112468521-112468543 GTCCCAGGTGCAGATGAGGCTGG + Intronic
1103020279 12:117528445-117528467 CCCCCAAATGAGGATGGGGAAGG - Intronic
1103449460 12:121018252-121018274 GCACCAAATGAGGACGGGGCAGG + Intergenic
1103559970 12:121788518-121788540 TCCCCAAGTGGGCATGGGGTTGG - Intronic
1103700755 12:122847662-122847684 TCCCCAAGGGGAGATGGGGCCGG + Intronic
1104479749 12:129097099-129097121 GCCCCAAATGTGGACAGGGCAGG - Intronic
1104806240 12:131591322-131591344 GCCCCAGGTGTGCAGGGGGCAGG - Intergenic
1105600089 13:21878892-21878914 GGCCCCTGTGCGGATGGGACAGG - Intergenic
1106617925 13:31347469-31347491 GCCCCAAGTGAGGACGGGACGGG - Intergenic
1106831359 13:33586800-33586822 CACCCAAGTTAGGATGGGGCAGG - Intergenic
1110661374 13:78062119-78062141 GCCCCAAGTGAGGACAGGGCAGG - Intergenic
1114265490 14:21070627-21070649 GACCCAAGGGAGGATGGGGGAGG - Intronic
1116898955 14:50343645-50343667 GCTCCATGTGCTGATGGGGGTGG - Intronic
1122648054 14:103207837-103207859 GCGCCAGGTGCTGATGGCGCGGG + Intergenic
1123630264 15:22256274-22256296 GCCCAAGGTGTGGAGGGGGCTGG + Intergenic
1123909965 15:24956383-24956405 GCCGCCAGTGGGGAGGGGGCAGG + Intronic
1129115723 15:73364367-73364389 ACCCCAAGTGCAGATGTAGCTGG - Intronic
1130843444 15:87723233-87723255 GCCCTGAGGGCTGATGGGGCTGG - Intergenic
1131259921 15:90882930-90882952 GCCCCAAGTCCTGAAGAGGCGGG + Exonic
1133963501 16:10514674-10514696 GACCCAACTGCTGCTGGGGCTGG + Intergenic
1136171735 16:28494165-28494187 CCCCCAGGGGCGGAAGGGGCCGG - Intronic
1138384468 16:56626673-56626695 GCCCTAAATTCAGATGGGGCAGG + Intronic
1138385567 16:56633547-56633569 GCCCTAAATTCAGATGGGGCAGG + Intronic
1140504828 16:75464638-75464660 GCCCGAAGTGCGGTAGCGGCCGG + Exonic
1141424093 16:83934405-83934427 GCCCCGAGGGGGGCTGGGGCTGG - Intronic
1141972822 16:87494369-87494391 GCCCAAGGTGTGGAGGGGGCTGG - Intergenic
1142197187 16:88744379-88744401 GCCCCACGTGCCTGTGGGGCAGG - Intronic
1142313337 16:89326877-89326899 GCCCCACGTGCAGATGTGCCCGG - Intronic
1142904470 17:3033017-3033039 GCCCCATGTGGGGAGAGGGCTGG - Intronic
1143137376 17:4719414-4719436 GCACCATGTGAGGGTGGGGCTGG + Exonic
1144663986 17:17089849-17089871 CCCCCAACTGAGGACGGGGCTGG - Intronic
1146120956 17:30194008-30194030 TTCCCAGGTGAGGATGGGGCTGG - Intergenic
1151948022 17:77330004-77330026 GCCCCAGCTGGGGATGGAGCGGG - Intronic
1151983543 17:77528269-77528291 GCCCCAGAGGCGGATGGGCCAGG + Intergenic
1154293482 18:13130643-13130665 GCACCCAGTGGGGATGGGGCTGG - Intergenic
1155657466 18:28208966-28208988 GCACCAAATGAGAATGGGGCAGG + Intergenic
1155804226 18:30145487-30145509 GCCCCAAATGAGGATGGGGCAGG - Intergenic
1159915834 18:74186976-74186998 GCCCCAACTGAGGATGGGACAGG - Intergenic
1160453383 18:78979904-78979926 GCCCCGGGTGCGGCTGTGGCGGG - Intergenic
1160791475 19:925636-925658 GCCCCAAGCGCAGAGGGTGCCGG - Intergenic
1160847622 19:1173487-1173509 GCCCCAGGAGCGGGAGGGGCGGG + Intronic
1160865931 19:1255918-1255940 GCCCCGGGTGGGGGTGGGGCAGG - Intronic
1161801069 19:6416957-6416979 GCCCCGGGTGCTGAAGGGGCTGG - Intronic
1162209039 19:9077250-9077272 GCCCCAAGTGAGGACGGGGCAGG + Intergenic
1162310733 19:9905664-9905686 GCCACTAGTGCTGAAGGGGCCGG + Intronic
1162996435 19:14338841-14338863 GCCCCACGTGCCCCTGGGGCTGG - Intergenic
1163333966 19:16659829-16659851 GCCCAGAGGGCGGATAGGGCGGG + Intronic
1163513370 19:17748681-17748703 GTCCCCAGTGCAGCTGGGGCAGG - Intronic
1163721510 19:18900210-18900232 GCCCCAGGTGAGGATGGGTTGGG + Intronic
1163722493 19:18904911-18904933 GCCCCAAGTGGGGACAAGGCAGG - Intronic
1164237622 19:23350850-23350872 GCCCCAAGTAAGGACAGGGCAGG - Intronic
1164405020 19:27936792-27936814 GCCCCAAGTGGGGCTGGCACCGG + Intergenic
1166210967 19:41306365-41306387 GCCCTAGGTGAGGGTGGGGCTGG + Intronic
1167253611 19:48414654-48414676 GTCCCAAGGGAGGAGGGGGCTGG - Intronic
1167791731 19:51687807-51687829 GGCCCAGGAACGGATGGGGCAGG - Intergenic
1168315014 19:55481236-55481258 GCCTCTACTGCGGAGGGGGCCGG + Exonic
931645056 2:64414636-64414658 GTCACAACTGGGGATGGGGCTGG - Intergenic
932103473 2:68922420-68922442 GCCCCAAGCCCTGCTGGGGCTGG - Intergenic
932715788 2:74100178-74100200 ACCCCCAGTGGGGCTGGGGCTGG + Intronic
933246134 2:79976789-79976811 GCCCCAAGTGGGGAAGGAACTGG - Intronic
933738892 2:85517407-85517429 GCCCAAAGTGCAGCTGTGGCAGG + Intergenic
935754400 2:106265803-106265825 GCCCCAAGTAAGGATAGGGCAGG + Intergenic
936389100 2:112055534-112055556 GCACCAGGTGCGGGTGTGGCAGG + Exonic
941243993 2:163073888-163073910 CCCCCAAGTGCAGAAGGAGCTGG - Intergenic
942221089 2:173769790-173769812 GATGCAAGTGCAGATGGGGCAGG + Intergenic
947384886 2:229580997-229581019 ACCCCCAGTGGGGATGGGGCCGG + Intronic
948327726 2:237139984-237140006 GCCCCATGCGCTGCTGGGGCTGG + Intergenic
949048719 2:241885398-241885420 GCCCCAGGTGGGGAGGTGGCAGG + Intergenic
1170688128 20:18587768-18587790 GACCCAGATGTGGATGGGGCAGG + Intronic
1172117416 20:32581265-32581287 GGCCCAAGTGGGGGTGGGGCAGG - Intronic
1172697998 20:36835544-36835566 GACCCGAGTGGGGAGGGGGCGGG - Intronic
1175268587 20:57717792-57717814 GCTCCATGTGCAGATGGGACAGG - Intergenic
1175903416 20:62368693-62368715 GCTCCAAGTGGGGGAGGGGCTGG + Intergenic
1175926565 20:62474273-62474295 GCGCCGAGTGGGGGTGGGGCAGG + Intronic
1176140552 20:63542971-63542993 GCCCCAAGGGCGGAAGGTGTGGG - Intronic
1176959338 21:15141703-15141725 GCCACAAGTGCCAAGGGGGCAGG + Intergenic
1178824720 21:36005296-36005318 GCCCCAAATGAGCACGGGGCAGG - Intergenic
1179666563 21:42916867-42916889 GCCCCAAGTGAGGATGGGGCAGG + Intergenic
1179667992 21:42925629-42925651 GCCCCAAGTGAGGAGGGGGCAGG + Intergenic
1180750462 22:18120898-18120920 ACCCCAAGAGAGGATGGGGAGGG - Intronic
1181052582 22:20244783-20244805 GCCCCACATGCTCATGGGGCAGG + Intronic
1181112400 22:20609758-20609780 GCCCCAAGTGCCGGTGGGTTGGG - Intergenic
1181236188 22:21448889-21448911 GGCTTAAGTGCTGATGGGGCGGG - Exonic
1181533986 22:23532395-23532417 TCCCCAGGTCAGGATGGGGCTGG - Intergenic
1181595473 22:23911762-23911784 GCCCCAGGTGAGGACGGGGCAGG - Intergenic
1181646820 22:24235864-24235886 GCCCCAAGAGGGAATGGGCCAGG + Intronic
1182344142 22:29648498-29648520 GCACCAAGTGTGGAAGGGACGGG + Intronic
1183525017 22:38317528-38317550 GCCCCCAGCGCGGAGGGCGCGGG - Intronic
1183934875 22:41256366-41256388 TCCCCAAGTGAGGATATGGCAGG + Intronic
950090460 3:10290972-10290994 GCCCCAAGTGGGCATGGCCCTGG + Exonic
950668863 3:14513435-14513457 GGACCAAGTGGGGATGGGGTTGG - Intronic
950723575 3:14901309-14901331 ACCCCAGGTGCTGATGGGGGTGG - Intronic
952734315 3:36673826-36673848 GCTCCAAGTGTGGATGCTGCTGG - Intergenic
954384847 3:50238579-50238601 GCCCCAGGTCAGGATGGGGAGGG + Intronic
954558057 3:51533807-51533829 GCCCCAAGTGAGGATGGGGCAGG + Intergenic
961424987 3:126838012-126838034 GTCCACAGTGCAGATGGGGCGGG + Intronic
965871800 3:173274314-173274336 GCACCAAATGAGGATGGAGCAGG - Intergenic
969638624 4:8383594-8383616 ACCCCAAGTCAGGATGGGGCAGG - Intronic
970672649 4:18414377-18414399 GCCCCAAGTGGGAATGAGGGCGG + Intergenic
971480582 4:27111038-27111060 GCCCCAAGTGAGGACGGGGCAGG + Intergenic
974489638 4:62548275-62548297 GCCCCAAATGAGGACGGGGGAGG + Intergenic
974950872 4:68582046-68582068 GCCCCAAGTGAGGATGGGACAGG - Intronic
974958413 4:68671998-68672020 GCCCCAAGTGAGGATGGGACAGG - Intergenic
978035401 4:103986443-103986465 GCCCCAAGTGCAGCTCTGGCAGG - Intergenic
980122010 4:128737444-128737466 GCCCCAAATGAGGACGGGGGAGG - Intergenic
980731952 4:136835290-136835312 GCCCCAAGTGAGGATGGCACAGG - Intergenic
983817993 4:172156110-172156132 GCGTCAAGTGAGGACGGGGCAGG + Intronic
985783488 5:1882543-1882565 GCCGGTAGGGCGGATGGGGCGGG - Intronic
985962584 5:3313959-3313981 ACCCTAAGTGCTCATGGGGCAGG + Intergenic
988486034 5:31668921-31668943 CTCCCAAGTGGGGCTGGGGCTGG + Intronic
989003454 5:36784229-36784251 GCCCCAAATGAGGACTGGGCAGG - Intergenic
989095507 5:37777788-37777810 GCACCAAATGAGGATGGGGCAGG - Intergenic
989586186 5:43075393-43075415 GCCCCAAGTGAGGACGGTACAGG + Intronic
990449950 5:55924647-55924669 GCCCCAAGGGCGCGTGGGGGTGG - Intergenic
990499312 5:56379504-56379526 GCCCCACCTGAGGATGGGTCAGG + Intergenic
992080796 5:73233344-73233366 GCTTCAAGGGCGGATGTGGCTGG + Intergenic
993290252 5:86059021-86059043 TCCCTAAGTGTGAATGGGGCTGG + Intergenic
995852345 5:116559469-116559491 GCCCCAAGTGCGGATGGGGCAGG - Intronic
997610283 5:135210963-135210985 GCCCAAATTGCAGATGGGGAAGG + Intronic
999413542 5:151374268-151374290 GCCCCAAGTGAGGACAGGACAGG - Intergenic
1002567059 5:180118215-180118237 GCCCCAAGTGGGGAGGAGCCTGG + Intronic
1002598364 5:180339004-180339026 GCCCCCAGGGCAGATGGGACAGG + Intronic
1004491455 6:16120752-16120774 GCCCGAGGTGCTGATGGAGCTGG - Intergenic
1007092114 6:39190884-39190906 GCCCCAAGGGCACATGAGGCAGG - Exonic
1009494737 6:64332673-64332695 GCCTCCAGTGTGGATGGAGCAGG - Intronic
1009950943 6:70394866-70394888 GCACCAAATGAGGATGGGGCAGG - Intergenic
1011765059 6:90611215-90611237 GCCCAAACTGCGGCTGGGGAAGG - Intergenic
1011813490 6:91160427-91160449 GCACCAAACGAGGATGGGGCAGG + Intergenic
1013538878 6:111087943-111087965 CCCCCGAGGGCGGCTGGGGCTGG + Exonic
1017015779 6:150098485-150098507 GCACCAAATGAGGACGGGGCAGG - Intergenic
1017016131 6:150100928-150100950 GCACCAAATGAGGATGGGGCAGG - Intergenic
1019327525 7:445689-445711 GCCCGCAGTGGGGAAGGGGCAGG - Intergenic
1021499014 7:21308633-21308655 TCCCAAAGTGCTGCTGGGGCTGG + Intergenic
1026393498 7:69927757-69927779 GCCCCATGTGAGGCTGTGGCTGG + Intronic
1029589834 7:101500100-101500122 GCCCCAAATGCAGAAGGGGCAGG - Intronic
1030636483 7:111954718-111954740 GCCCCATGTGAGGACGGGGCAGG - Intronic
1034573835 7:151980437-151980459 GACCCAAGTGCAGACGGTGCAGG + Intronic
1034580324 7:152035838-152035860 GCCCCAAGTGAGGATGGGGAAGG + Intronic
1037387411 8:18358233-18358255 GCCCAAGGTGGGGATGGGACAGG - Intergenic
1037512473 8:19597960-19597982 GCCCCAGGCTGGGATGGGGCTGG - Intronic
1042157678 8:65863474-65863496 GCCCCAAATGAGGATGGGGCAGG - Intergenic
1042158713 8:65870323-65870345 GCCCCAAATGAGGATGGGGCAGG - Intergenic
1043506692 8:80909835-80909857 GCCCCAAATGAGGATGGGGCAGG + Intergenic
1043856756 8:85273712-85273734 GCCCCAAGTGAGGATGGGGCAGG - Intronic
1043856790 8:85273896-85273918 GCCCCAAGTGAGGACAGGGCAGG + Intronic
1043857394 8:85277743-85277765 GCCGGAAGTGAGGACGGGGCAGG + Intronic
1045131152 8:99154661-99154683 GCCCCAGGTGCTAATGTGGCAGG - Intronic
1049557713 8:143291348-143291370 GCCGGAAGTGCCGAGGGGGCGGG + Intronic
1049624638 8:143614553-143614575 CCCCCAGGGGCGGGTGGGGCCGG - Intronic
1049853791 8:144849174-144849196 TCCCCAGATGTGGATGGGGCTGG - Intronic
1050487524 9:6149616-6149638 GCACCAAATGAGGATGGGGCAGG - Intergenic
1051096424 9:13471156-13471178 GCCCCAAATGTGGATGGTGTTGG + Intergenic
1056716782 9:89037966-89037988 GCACCCAGTGGGGGTGGGGCCGG - Intronic
1057995589 9:99819902-99819924 GCCGGGAGTGCGGAGGGGGCGGG - Intergenic
1058286822 9:103189077-103189099 GCCCCAACTGAGGATGGGACAGG + Intergenic
1060220049 9:121759733-121759755 GCCCTAAGTCAGGATGAGGCAGG - Intronic
1060733650 9:126052803-126052825 GCCCCAGGTGGAGATGAGGCCGG + Intergenic
1061050388 9:128191572-128191594 GGCCCAAATGCGGGCGGGGCCGG + Exonic
1061246500 9:129403568-129403590 TCCCCAGGTCAGGATGGGGCCGG + Intergenic
1061253653 9:129440974-129440996 GACTCAAGTGCAGCTGGGGCGGG - Intergenic
1061419296 9:130464508-130464530 ACCCCAGGTGCGGGTGGGGATGG + Intronic
1061632758 9:131883527-131883549 GCACAAAGTGGGGAAGGGGCAGG + Intronic
1062326843 9:136016606-136016628 GCACCAAGTAGGGATGGGGCAGG - Intronic
1062557034 9:137117701-137117723 GCCCCAAGTGCGGATGCAGTAGG - Intergenic
1062656160 9:137605462-137605484 GCCACACGGACGGATGGGGCGGG + Intergenic
1189433825 X:40973386-40973408 GCACTAAGTGGGGATGGGGTGGG + Intergenic
1191861085 X:65667372-65667394 GCCCTGAGTGGGGGTGGGGCTGG + Intronic
1192180404 X:68912412-68912434 GACCCAAGCAGGGATGGGGCCGG - Intergenic
1192946540 X:75969527-75969549 GCCCCAAGTGAGGACAGGGCAGG + Intergenic
1200257214 X:154589618-154589640 CCCACAGGTGTGGATGGGGCTGG + Intergenic
1200260556 X:154614784-154614806 CCCACAGGTGTGGATGGGGCTGG - Intergenic