ID: 995856823

View in Genome Browser
Species Human (GRCh38)
Location 5:116601190-116601212
Sequence GGCTGAAATCCTGTGTTGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995856818_995856823 -5 Left 995856818 5:116601172-116601194 CCTCTCCCTCCTCTGAGGGGCTG No data
Right 995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG No data
995856810_995856823 9 Left 995856810 5:116601158-116601180 CCTCTGCCCTCCCTCCTCTCCCT No data
Right 995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG No data
995856814_995856823 -1 Left 995856814 5:116601168-116601190 CCCTCCTCTCCCTCCTCTGAGGG No data
Right 995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG No data
995856812_995856823 2 Left 995856812 5:116601165-116601187 CCTCCCTCCTCTCCCTCCTCTGA No data
Right 995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG No data
995856816_995856823 -2 Left 995856816 5:116601169-116601191 CCTCCTCTCCCTCCTCTGAGGGG No data
Right 995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG No data
995856811_995856823 3 Left 995856811 5:116601164-116601186 CCCTCCCTCCTCTCCCTCCTCTG No data
Right 995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG No data
995856819_995856823 -10 Left 995856819 5:116601177-116601199 CCCTCCTCTGAGGGGCTGAAATC No data
Right 995856823 5:116601190-116601212 GGCTGAAATCCTGTGTTGACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995856823 Original CRISPR GGCTGAAATCCTGTGTTGAC GGG Intergenic
No off target data available for this crispr