ID: 995858986

View in Genome Browser
Species Human (GRCh38)
Location 5:116622186-116622208
Sequence GGAATGTGGGGTCACAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995858979_995858986 7 Left 995858979 5:116622156-116622178 CCTACAGCTGATACGGTCTGGGA No data
Right 995858986 5:116622186-116622208 GGAATGTGGGGTCACAGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995858986 Original CRISPR GGAATGTGGGGTCACAGTGA GGG Intergenic
No off target data available for this crispr