ID: 995859867

View in Genome Browser
Species Human (GRCh38)
Location 5:116629730-116629752
Sequence TTAAGTTTACCTAGGAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995859863_995859867 -1 Left 995859863 5:116629708-116629730 CCTGTCACTGGCCTTCCTCTTGT No data
Right 995859867 5:116629730-116629752 TTAAGTTTACCTAGGAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995859867 Original CRISPR TTAAGTTTACCTAGGAAAAC AGG Intergenic
No off target data available for this crispr