ID: 995861352

View in Genome Browser
Species Human (GRCh38)
Location 5:116644179-116644201
Sequence AACGAGATTATGGAGTAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995861352_995861358 27 Left 995861352 5:116644179-116644201 CCAGTCTACTCCATAATCTCGTT No data
Right 995861358 5:116644229-116644251 GCTTCACAAAGATAGGATGTTGG No data
995861352_995861355 20 Left 995861352 5:116644179-116644201 CCAGTCTACTCCATAATCTCGTT No data
Right 995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995861352 Original CRISPR AACGAGATTATGGAGTAGAC TGG (reversed) Intergenic