ID: 995861354

View in Genome Browser
Species Human (GRCh38)
Location 5:116644189-116644211
Sequence CAGCAACCAAAACGAGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995861354_995861355 10 Left 995861354 5:116644189-116644211 CCATAATCTCGTTTTGGTTGCTG No data
Right 995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG No data
995861354_995861358 17 Left 995861354 5:116644189-116644211 CCATAATCTCGTTTTGGTTGCTG No data
Right 995861358 5:116644229-116644251 GCTTCACAAAGATAGGATGTTGG No data
995861354_995861359 23 Left 995861354 5:116644189-116644211 CCATAATCTCGTTTTGGTTGCTG No data
Right 995861359 5:116644235-116644257 CAAAGATAGGATGTTGGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995861354 Original CRISPR CAGCAACCAAAACGAGATTA TGG (reversed) Intergenic