ID: 995861355

View in Genome Browser
Species Human (GRCh38)
Location 5:116644222-116644244
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 299
Summary {0: 20, 1: 32, 2: 26, 3: 28, 4: 193}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995861354_995861355 10 Left 995861354 5:116644189-116644211 CCATAATCTCGTTTTGGTTGCTG 0: 5
1: 22
2: 10
3: 16
4: 100
Right 995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG 0: 20
1: 32
2: 26
3: 28
4: 193
995861352_995861355 20 Left 995861352 5:116644179-116644201 CCAGTCTACTCCATAATCTCGTT 0: 4
1: 12
2: 22
3: 30
4: 105
Right 995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG 0: 20
1: 32
2: 26
3: 28
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902061321 1:13645775-13645797 AAATCTTGCCTCACACAGATAGG + Intergenic
905008872 1:34733270-34733292 TAACCCTGCTTCACAGACAAAGG - Intronic
907827394 1:58032055-58032077 AAACTCTGCTTCTCAAAGTGTGG + Intronic
908899697 1:68942413-68942435 AAAGCCAGCTTCACAAATGTTGG - Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909662269 1:78097317-78097339 AAACTCTGCCTCACTAAGACTGG - Intronic
910578987 1:88800484-88800506 AAACCCACCTTAGCAAAGATGGG + Intronic
910824074 1:91387271-91387293 GAATTCTGCTTCACAATGATAGG + Intronic
911293004 1:96080773-96080795 GAAGGCTGCCTCACAAAGATTGG - Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
913087640 1:115453632-115453654 AAACACTGCTTTACCATGATTGG + Intergenic
913249544 1:116901147-116901169 AAACGCTGCAGCACAAGGATGGG + Intergenic
913650302 1:120907202-120907224 AAAACCTCCTCCACAAATATTGG + Intergenic
914170816 1:145221872-145221894 AAAACCTCCTCCACAAATATTGG - Intergenic
914525931 1:148465831-148465853 AAAACCTCCTCCACAAATATTGG - Intergenic
916004124 1:160644254-160644276 CACCCCTGCTTCCCAAACATAGG + Intronic
916639900 1:166716598-166716620 AGACCCTGCCTCAAAAAGAAAGG + Intergenic
917215227 1:172671294-172671316 GAACCCTCCTCCACAAAGAATGG - Intergenic
917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG + Intronic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918152836 1:181813139-181813161 AATCCCTGCTTTCCAAACATAGG - Intergenic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919838369 1:201592090-201592112 AAGCCCTGCTTCAGGAAGAGAGG - Intergenic
920208691 1:204312679-204312701 AATCCCAGTTCCACAAAGATGGG + Intronic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922180673 1:223230610-223230632 CAACCCTGCTTCACACGCATCGG - Intronic
922273194 1:224053260-224053282 AACACCTGCTACTCAAAGATGGG + Intergenic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923558399 1:235020221-235020243 ACACCCTGCTTCTTAAAGGTAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924788757 1:247223643-247223665 AAACCATGCTTCATAAATAAAGG + Intergenic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1063865247 10:10357633-10357655 TAACCCTGGATCAGAAAGATGGG - Intergenic
1067014184 10:42743974-42743996 AAACACTGCTACACTAAGCTAGG - Intergenic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1069998099 10:72355335-72355357 AAACCATGCCTCACAAACAGTGG - Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG + Intronic
1072978820 10:100082073-100082095 CAGCCATGCTTCAGAAAGATAGG - Intergenic
1074628204 10:115218278-115218300 AAACTCTGCTCCACGAAGACAGG + Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1080786954 11:35484243-35484265 AAACTGAGATTCACAAAGATTGG + Intronic
1081001754 11:37682418-37682440 ATATCCTGCTTCACTAAGATAGG - Intergenic
1081861143 11:46333937-46333959 AGACCCTGCTGCCCAGAGATGGG + Intronic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1089946652 11:122480633-122480655 AAAGCCTGCTCAAGAAAGATAGG + Intergenic
1090709372 11:129372322-129372344 AAAACCTACTTCACAAGGATGGG - Intergenic
1091363209 11:134994619-134994641 AAACCCTTTTTCACAAAGGAGGG + Intergenic
1091660073 12:2376824-2376846 CCTCCCTGCTTCACAGAGATGGG + Intronic
1092252335 12:6906645-6906667 AAACCCTGAATCTCAAAGGTGGG + Exonic
1093859376 12:24144650-24144672 AAACCATTTTTCATAAAGATGGG - Intergenic
1094257637 12:28451868-28451890 AAACCCAGTCTCACACAGATAGG - Intronic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1098331554 12:69358995-69359017 AGACACTGCTTCAGAAGGATGGG - Intergenic
1100383894 12:94087776-94087798 AGAGCCTGCTTCCCAAAGAAAGG - Intergenic
1101486194 12:105163509-105163531 AGACCCTGCCTCAAAAAGAAAGG - Intronic
1103347124 12:120258567-120258589 AAACCCTGCTTTTCCATGATGGG - Intronic
1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG + Intergenic
1106855795 13:33851235-33851257 ATTTCCTGCTTTACAAAGATTGG + Intronic
1110639583 13:77806720-77806742 AAACTTTGCTTCACAAACTTGGG - Intergenic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1115108284 14:29788158-29788180 AAACTCTCCTTCAAAAATATAGG - Intronic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1117702144 14:58424895-58424917 AAACCTAGCATCACAAACATGGG + Intronic
1118056963 14:62089008-62089030 AAACCTTGGATCAGAAAGATGGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121034325 14:90687638-90687660 CAAACCTGCTTCACAATGAGGGG + Intronic
1121665883 14:95671894-95671916 AAAATGTGCTTCACAAAGCTAGG + Intergenic
1122098050 14:99386040-99386062 ACACCCTGCTTCATGAAGACGGG + Intergenic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1125301831 15:38262967-38262989 AAGCCCTGCTTTACACAAATTGG - Intronic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1131875939 15:96806655-96806677 AAACCCTTCTACAGAAAGTTTGG + Intergenic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1139405929 16:66717699-66717721 TATCCCTACTTTACAAAGATGGG + Intergenic
1139437711 16:66946160-66946182 AGACCCTGCCTCAAAAAAATAGG + Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG + Intronic
1142795177 17:2302241-2302263 AGACCCTGCCTCAAAAAAATTGG + Intronic
1144287742 17:13794751-13794773 AATCCCTGGTTCAAAAAGTTGGG - Intergenic
1146474852 17:33154495-33154517 AATACCTGCTTCACCAAGATTGG - Intronic
1148015676 17:44520436-44520458 AAACACTGCTTTAAAAAGTTTGG - Intergenic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1150337320 17:64340176-64340198 AAACAGTGCTTCTCAAATATTGG + Intronic
1150712701 17:67545300-67545322 AGACCCTGCTTCTAAAATATGGG + Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1153784819 18:8525306-8525328 AAACCCTGCTTCCCAAAACAGGG + Intergenic
1153804728 18:8702368-8702390 AAACCCTGTCTCAAAAAAATGGG - Intergenic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1156130948 18:33973799-33973821 AAACCATGCTGTACACAGATGGG + Intronic
1157637550 18:49174614-49174636 ATTCCCTGAGTCACAAAGATTGG + Intronic
1157965330 18:52202514-52202536 ACACCCTGCCTCACAACAATTGG + Intergenic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160033731 18:75283007-75283029 AAACTCCCTTTCACAAAGATGGG + Intronic
1166259389 19:41627224-41627246 CAACCCTGCTTCTCAAAGTGTGG - Intronic
1167514396 19:49914627-49914649 GAACCCTGGTTCTCACAGATGGG - Intronic
1167844711 19:52152510-52152532 CAAGCCTGCTTCTCCAAGATTGG - Intergenic
926478494 2:13357928-13357950 TATCTCTGTTTCACAAAGATTGG - Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
929505174 2:42522727-42522749 AGACCCTGTCTCAGAAAGATGGG + Intronic
929707900 2:44235002-44235024 AAACCTGGCCTCACACAGATAGG + Intronic
931022416 2:58063145-58063167 AAACCATGCTGTAAAAAGATGGG - Intronic
932771052 2:74501050-74501072 AAAGACTCCTTGACAAAGATGGG + Intronic
933324965 2:80823758-80823780 AAGCCCTGTTTCCCAAAGCTTGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG + Intronic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937836775 2:126479191-126479213 AAACCCCACTTCATAAAGATAGG - Intergenic
938712533 2:133988049-133988071 AATCCCTGCCTCATAAAGAATGG - Intergenic
939012719 2:136865226-136865248 AAACCATGCTTCATAGAGAATGG + Intronic
939177783 2:138769655-138769677 AAATCCTGCTGCACTAAGCTGGG - Intronic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
939616824 2:144370909-144370931 AAACACTGCTTAATAAAGTTGGG + Intergenic
940564170 2:155339475-155339497 AAACCCTGCTTCTCAGAGGGAGG + Intergenic
940730017 2:157377636-157377658 AAACCCAATTTCATAAAGATAGG - Intergenic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944450452 2:199836752-199836774 AAACCCTGTTTCAAAAAAAAAGG + Intronic
945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG + Intronic
945577630 2:211552004-211552026 AAAACGTGGTTCACAATGATTGG - Intronic
946830094 2:223720010-223720032 ATACCCTGCTTCCCAAATGTTGG - Intergenic
1170581282 20:17701339-17701361 AACACCTGCTTCACAGAGGTCGG - Intronic
1170744220 20:19084355-19084377 AAATCCTGATTCCCAAAGATAGG - Intergenic
1172119442 20:32589221-32589243 AAACCCTGCCTCTGATAGATGGG + Intronic
1173422485 20:42914911-42914933 AGCCCCTGCCTCACACAGATTGG - Intronic
1175086154 20:56460915-56460937 GAACCAAGCCTCACAAAGATGGG - Intergenic
1175694980 20:61095740-61095762 GAAAACTGCTTCACAAAGATAGG + Intergenic
1176013745 20:62916725-62916747 AAATCTTGCCTCACACAGATAGG + Intronic
1176193735 20:63826918-63826940 AAACCCTGCTTCCCGGAGAGTGG - Intronic
1176550366 21:8218333-8218355 GAATTCTGCTTCACAATGATAGG - Intergenic
1176569294 21:8401371-8401393 GAATTCTGCTTCACAATGATAGG - Intergenic
1176577208 21:8445603-8445625 GAATTCTGCTTCACAATGATAGG - Intergenic
1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG + Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1179462472 21:41547026-41547048 ACCCCCTGCCTCACAAAGCTGGG - Intergenic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
1203255261 22_KI270733v1_random:134671-134693 GAATTCTGCTTCACAATGATAGG - Intergenic
1203263317 22_KI270733v1_random:179750-179772 GAATTCTGCTTCACAATGATAGG - Intergenic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
952860571 3:37808994-37809016 AGACCCTGCTTCTCAATGAGAGG + Intronic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
955444826 3:58998607-58998629 ATATCCTCCTCCACAAAGATAGG - Intronic
955612707 3:60775009-60775031 AACCACTGCTTTATAAAGATGGG - Intronic
956613442 3:71147305-71147327 AAAGCCTGCCTTTCAAAGATGGG + Intronic
958535978 3:95403954-95403976 AACCCTTGCTTCACTAATATAGG + Intergenic
960001631 3:112737753-112737775 AAAACCTGCTTTACACAAATTGG + Intergenic
961435599 3:126914389-126914411 AAACCCTTATTCACAAAAACAGG + Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961865878 3:129953142-129953164 TAACTCTGCTTCTCAGAGATGGG - Intergenic
962556689 3:136559763-136559785 AAACTCAGCCTCTCAAAGATAGG - Intronic
962895181 3:139707548-139707570 AAACTCAGCTTCCCAATGATAGG - Intergenic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
964583402 3:158266754-158266776 AAACCCTGTATCAAAAAGAGGGG - Intronic
964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG + Intergenic
966369134 3:179228548-179228570 AAATCTGGCCTCACAAAGATAGG - Intronic
966681997 3:182651665-182651687 AAATCCTGTTGCACTAAGATCGG - Intergenic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
969065946 4:4481146-4481168 AAACCCTGGTACAAAATGATGGG + Intronic
970967987 4:21949278-21949300 AAATACTGCTGCACAAAGTTAGG + Intergenic
971619574 4:28838606-28838628 AAACCCAACTTCACACAGATAGG - Intergenic
973301039 4:48584654-48584676 ATACCCTGTATCACACAGATAGG - Intronic
974822921 4:67090818-67090840 GAATACTGCTTCAAAAAGATTGG - Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG + Intergenic
978364270 4:107964354-107964376 AAACACTAATTCACAAACATGGG - Intergenic
978642836 4:110891762-110891784 TAGCCCTGCTCCACAAGGATTGG + Intergenic
979300364 4:119080003-119080025 AAATCCTTCTCCACAAATATTGG - Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980991343 4:139741006-139741028 AAACCCAGCTTCCCACAGACAGG - Intronic
981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
984247841 4:177296665-177296687 AGACCCTGCTTCAAAAAAAAAGG + Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
986661389 5:10063271-10063293 AAACCATGCTTTACAGAAATGGG - Intergenic
987267385 5:16270984-16271006 AAACAGTGCTGCACAAACATGGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988272124 5:29031096-29031118 AAACCCTGGTCCCCAAAGAAGGG + Intergenic
988912221 5:35854850-35854872 TAAGCCTGATTCACAAAAATTGG - Intronic
989981405 5:50649745-50649767 AAAACCTCCTCCACAAATATTGG + Intergenic
992950657 5:81853989-81854011 AAAGCCTGATTTACAAAGACTGG + Intergenic
993034079 5:82737709-82737731 CAACCATGCTTCACACAGAAAGG + Intergenic
993411923 5:87584716-87584738 AAACCCCACTTAACAAAGAATGG + Intergenic
993872347 5:93267773-93267795 CACCCCTGCTTGACACAGATAGG + Intergenic
993953997 5:94210109-94210131 TAATCATGCTCCACAAAGATGGG - Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996039161 5:118791277-118791299 AAAACTTTCTTCACAAAAATAGG - Intergenic
997065382 5:130553630-130553652 TAGCCCTGCTTCAGAAAGAGCGG + Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998670655 5:144349525-144349547 AAGCCCTCATTCACTAAGATTGG + Intronic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
1001225947 5:169944639-169944661 AATCCCCACTTCACAATGATTGG + Intronic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1003124186 6:3342495-3342517 AAACAGTGCTTCTCAAAGGTGGG + Intronic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004633852 6:17447829-17447851 AAACCATGCCTCAGAAAGGTTGG + Intronic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1006383954 6:33718500-33718522 AGCCCCTGCTCCACAGAGATGGG + Intergenic
1006969667 6:38028852-38028874 ATGCCTTGCTTCACAAAGAAAGG - Intronic
1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG + Intronic
1008374302 6:50773794-50773816 AAGTCCTGCTTCTCAGAGATGGG + Intergenic
1010642688 6:78348875-78348897 AATACATGCTTTACAAAGATGGG - Intergenic
1011239138 6:85252353-85252375 AAACCCACCTCCCCAAAGATGGG + Intergenic
1011673887 6:89712326-89712348 AAAACCTCTTTCACAAATATTGG + Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1014630615 6:123785200-123785222 AAACCCAGATGCAGAAAGATGGG - Intergenic
1014827757 6:126065961-126065983 AAATGCTGCTAGACAAAGATGGG + Intergenic
1015828990 6:137347009-137347031 CAACCCTGCCTCAAAAAGAAAGG + Intergenic
1016183265 6:141172471-141172493 AAACCTTTATTCACAAAAATGGG - Intergenic
1016442483 6:144098021-144098043 AAACCCTCATTCACATAGATAGG + Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1018855327 6:167670430-167670452 AAACCCTGCTCCAGAAGCATGGG + Intergenic
1018980913 6:168601196-168601218 AATGCCTGTTTCACCAAGATCGG + Intronic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1020946382 7:14613608-14613630 AAAACCTCCTCCACAAAGAAAGG + Intronic
1020982633 7:15090454-15090476 AAAACATGCTTTACAAAGAATGG + Intergenic
1022122410 7:27322067-27322089 AAACCCTCCTTCAGAAGGAAAGG + Intergenic
1022243156 7:28532093-28532115 GAACCCTGTTTCACAAATGTTGG - Intronic
1023653650 7:42397387-42397409 AAATCCAGCCTCACACAGATAGG - Intergenic
1024062970 7:45712850-45712872 AATTTCTGCTTCACAAAGTTAGG - Intronic
1024747724 7:52427547-52427569 CAGCCCTGCTTCACAAGGAGTGG + Intergenic
1026649941 7:72208181-72208203 AAATCCTGATTCACATAGATGGG + Intronic
1026912636 7:74100225-74100247 AAACCCTGTCTCAAAAAAATGGG + Intronic
1027795691 7:82691048-82691070 AAATCCTGCATCAAAAAGACAGG - Intergenic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1031514550 7:122685986-122686008 AAAACCAGCTTCACAAATACTGG - Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1040507921 8:48068205-48068227 AAAGCCAGGTTCACAAAGCTTGG + Intergenic
1041812741 8:61929783-61929805 GAACCCTGGTTTACAAAGTTTGG + Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043231160 8:77803115-77803137 AAACCCTGCTTTGGAAAGATAGG + Intergenic
1043306249 8:78800305-78800327 AAACCCTGTCTCAAAAAGAGAGG - Intronic
1043969073 8:86510494-86510516 AAACCCTGCTTTAAACCGATGGG - Intronic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046373769 8:113348499-113348521 CATCCCTGCTTCTCAAAGCTGGG - Intronic
1046438816 8:114231259-114231281 ATATCCTGCTTCACAAGGACTGG + Intergenic
1049538855 8:143196751-143196773 AAACCCTCCTTTAGATAGATAGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1050101539 9:2125004-2125026 AATCCATGTTTCACAAAGCTTGG - Intronic
1050644746 9:7707221-7707243 AAAACCTGCTCTAGAAAGATTGG + Intergenic
1052125753 9:24772748-24772770 ACACCCTGCTTCATAAAGGTTGG - Intergenic
1052838058 9:33265871-33265893 AAACAGTGGTTCACAAAGAAGGG - Intronic
1056369382 9:85939306-85939328 AAACCGAACTTCACAAAAATTGG - Intergenic
1056689102 9:88791082-88791104 AAATTCTGCTTCAAAAAAATTGG - Intergenic
1057318862 9:93993429-93993451 AAAGCCTTCTTTACAAAAATAGG + Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058041080 9:100302685-100302707 AATCTCTTCTTTACAAAGATGGG + Intronic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1058646207 9:107133757-107133779 AAATCCAACTTCACACAGATAGG + Intergenic
1203471659 Un_GL000220v1:117808-117830 GAATTCTGCTTCACAATGATAGG - Intergenic
1203479480 Un_GL000220v1:161780-161802 GAATTCTGCTTCACAATGATAGG - Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188246239 X:27839369-27839391 AAACCCTGCTTTGTAAAGATAGG - Intergenic
1188455018 X:30354351-30354373 AAACCTTGCTTTACAAATCTGGG + Intergenic
1189211748 X:39289686-39289708 ATAACCTACTTCACAAAGTTAGG + Intergenic
1189515764 X:41712113-41712135 AAATCCTGCGTCAAAAAGGTGGG + Intronic
1194193022 X:90860230-90860252 ACACTCTGTTTCACAGAGATAGG + Intergenic
1194589726 X:95784995-95785017 ACACCCAGCTTTCCAAAGATTGG - Intergenic
1195133903 X:101884174-101884196 AAAACTTGTTTCAGAAAGATAGG - Exonic
1195616269 X:106914459-106914481 AAATCCAGCCCCACAAAGATAGG - Intronic
1195698651 X:107685355-107685377 ATGCCCTGCTTCCCAAAGCTTGG + Intergenic
1198340311 X:135707736-135707758 AAACCCTGTCTCAAAAAGAATGG - Intergenic
1198343792 X:135740453-135740475 AAACCCTGTCTCAAAAAGAATGG - Intergenic
1199144115 X:144346086-144346108 AAAGCCTTCTTAAAAAAGATGGG - Intergenic
1199494750 X:148440765-148440787 AAACTATGCTTCACACAGCTAGG - Intergenic
1200539642 Y:4442680-4442702 ACACTCTGTTTCACAGAGATAGG + Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic