ID: 995861355 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:116644222-116644244 |
| Sequence | AAACCCTGCTTCACAAAGAT AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 995861352_995861355 | 20 | Left | 995861352 | 5:116644179-116644201 | CCAGTCTACTCCATAATCTCGTT | No data | ||
| Right | 995861355 | 5:116644222-116644244 | AAACCCTGCTTCACAAAGATAGG | No data | ||||
| 995861354_995861355 | 10 | Left | 995861354 | 5:116644189-116644211 | CCATAATCTCGTTTTGGTTGCTG | No data | ||
| Right | 995861355 | 5:116644222-116644244 | AAACCCTGCTTCACAAAGATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 995861355 | Original CRISPR | AAACCCTGCTTCACAAAGAT AGG | Intergenic | ||