ID: 995865298

View in Genome Browser
Species Human (GRCh38)
Location 5:116683942-116683964
Sequence CTGTCTAAAGTGTTAGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995865298_995865304 1 Left 995865298 5:116683942-116683964 CCCTCCCCTAACACTTTAGACAG No data
Right 995865304 5:116683966-116683988 ATTCTGTATCCAGTGGATACAGG No data
995865298_995865303 -6 Left 995865298 5:116683942-116683964 CCCTCCCCTAACACTTTAGACAG No data
Right 995865303 5:116683959-116683981 AGACAGTATTCTGTATCCAGTGG No data
995865298_995865306 27 Left 995865298 5:116683942-116683964 CCCTCCCCTAACACTTTAGACAG No data
Right 995865306 5:116683992-116684014 AATAAATATAAGTTACTGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995865298 Original CRISPR CTGTCTAAAGTGTTAGGGGA GGG (reversed) Intergenic
No off target data available for this crispr