ID: 995865422

View in Genome Browser
Species Human (GRCh38)
Location 5:116685245-116685267
Sequence AGTCCTATGCAGACTGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995865418_995865422 9 Left 995865418 5:116685213-116685235 CCTTAAAACATACTGGACTCAAA No data
Right 995865422 5:116685245-116685267 AGTCCTATGCAGACTGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995865422 Original CRISPR AGTCCTATGCAGACTGTGGA GGG Intergenic
No off target data available for this crispr