ID: 995867474

View in Genome Browser
Species Human (GRCh38)
Location 5:116707020-116707042
Sequence CCTGAAGTCCGGCACCCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995867470_995867474 16 Left 995867470 5:116706981-116707003 CCTGGAGTAATAATTCATGCCAA No data
Right 995867474 5:116707020-116707042 CCTGAAGTCCGGCACCCTGCAGG No data
995867469_995867474 30 Left 995867469 5:116706967-116706989 CCAGGATTTTACAGCCTGGAGTA No data
Right 995867474 5:116707020-116707042 CCTGAAGTCCGGCACCCTGCAGG No data
995867471_995867474 -3 Left 995867471 5:116707000-116707022 CCAAGCTCTCTCTGCTATATCCT 0: 11
1: 64
2: 35
3: 31
4: 294
Right 995867474 5:116707020-116707042 CCTGAAGTCCGGCACCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995867474 Original CRISPR CCTGAAGTCCGGCACCCTGC AGG Intergenic
No off target data available for this crispr