ID: 995870189

View in Genome Browser
Species Human (GRCh38)
Location 5:116736440-116736462
Sequence TATCACTCTGGGCAGCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995870189_995870197 19 Left 995870189 5:116736440-116736462 CCAGGCTGCTGCCCAGAGTGATA No data
Right 995870197 5:116736482-116736504 GGAAAGAAGTTGAGTCCACACGG No data
995870189_995870198 29 Left 995870189 5:116736440-116736462 CCAGGCTGCTGCCCAGAGTGATA No data
Right 995870198 5:116736492-116736514 TGAGTCCACACGGAAATGCTAGG No data
995870189_995870195 -2 Left 995870189 5:116736440-116736462 CCAGGCTGCTGCCCAGAGTGATA No data
Right 995870195 5:116736461-116736483 TAGTAAGGTTGAGGAAACCTGGG No data
995870189_995870194 -3 Left 995870189 5:116736440-116736462 CCAGGCTGCTGCCCAGAGTGATA No data
Right 995870194 5:116736460-116736482 ATAGTAAGGTTGAGGAAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995870189 Original CRISPR TATCACTCTGGGCAGCAGCC TGG (reversed) Intergenic
No off target data available for this crispr