ID: 995879675

View in Genome Browser
Species Human (GRCh38)
Location 5:116830337-116830359
Sequence GAGGGTAGGACAGTGCCTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995879675_995879682 21 Left 995879675 5:116830337-116830359 CCAGCAGGCACTGTCCTACCCTC No data
Right 995879682 5:116830381-116830403 CATGTCCACGTGTGTGAAAGTGG No data
995879675_995879683 22 Left 995879675 5:116830337-116830359 CCAGCAGGCACTGTCCTACCCTC No data
Right 995879683 5:116830382-116830404 ATGTCCACGTGTGTGAAAGTGGG No data
995879675_995879685 29 Left 995879675 5:116830337-116830359 CCAGCAGGCACTGTCCTACCCTC No data
Right 995879685 5:116830389-116830411 CGTGTGTGAAAGTGGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995879675 Original CRISPR GAGGGTAGGACAGTGCCTGC TGG (reversed) Intergenic
No off target data available for this crispr