ID: 995882969

View in Genome Browser
Species Human (GRCh38)
Location 5:116863255-116863277
Sequence ATGGACAACTGGGCCTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995882969_995882974 26 Left 995882969 5:116863255-116863277 CCCACAAAGGCCCAGTTGTCCAT No data
Right 995882974 5:116863304-116863326 AGCTGATCAAAGAGAAGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995882969 Original CRISPR ATGGACAACTGGGCCTTTGT GGG (reversed) Intergenic
No off target data available for this crispr