ID: 995883269

View in Genome Browser
Species Human (GRCh38)
Location 5:116866093-116866115
Sequence TCACGATTACAGGGGCCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995883269_995883276 0 Left 995883269 5:116866093-116866115 CCCCTTGGCCCCTGTAATCGTGA No data
Right 995883276 5:116866116-116866138 TGGTAGTGTGTGTGCGTGTGCGG No data
995883269_995883279 24 Left 995883269 5:116866093-116866115 CCCCTTGGCCCCTGTAATCGTGA No data
Right 995883279 5:116866140-116866162 GAATGATTGGAGTGTGAAGGAGG No data
995883269_995883278 21 Left 995883269 5:116866093-116866115 CCCCTTGGCCCCTGTAATCGTGA No data
Right 995883278 5:116866137-116866159 GGAGAATGATTGGAGTGTGAAGG No data
995883269_995883277 11 Left 995883269 5:116866093-116866115 CCCCTTGGCCCCTGTAATCGTGA No data
Right 995883277 5:116866127-116866149 GTGCGTGTGCGGAGAATGATTGG No data
995883269_995883280 25 Left 995883269 5:116866093-116866115 CCCCTTGGCCCCTGTAATCGTGA No data
Right 995883280 5:116866141-116866163 AATGATTGGAGTGTGAAGGAGGG No data
995883269_995883281 29 Left 995883269 5:116866093-116866115 CCCCTTGGCCCCTGTAATCGTGA No data
Right 995883281 5:116866145-116866167 ATTGGAGTGTGAAGGAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995883269 Original CRISPR TCACGATTACAGGGGCCAAG GGG (reversed) Intergenic
No off target data available for this crispr