ID: 995887476

View in Genome Browser
Species Human (GRCh38)
Location 5:116912302-116912324
Sequence CTGTGTAAGTATATTTTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995887469_995887476 17 Left 995887469 5:116912262-116912284 CCAGGACAGCAGTTCCCTTCTCA No data
Right 995887476 5:116912302-116912324 CTGTGTAAGTATATTTTTCAGGG No data
995887473_995887476 2 Left 995887473 5:116912277-116912299 CCTTCTCATTTGGGATCGTTTTT No data
Right 995887476 5:116912302-116912324 CTGTGTAAGTATATTTTTCAGGG No data
995887472_995887476 3 Left 995887472 5:116912276-116912298 CCCTTCTCATTTGGGATCGTTTT No data
Right 995887476 5:116912302-116912324 CTGTGTAAGTATATTTTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995887476 Original CRISPR CTGTGTAAGTATATTTTTCA GGG Intergenic
No off target data available for this crispr