ID: 995890819

View in Genome Browser
Species Human (GRCh38)
Location 5:116948425-116948447
Sequence AGAGCACGAGAAAAAGAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995890819_995890821 17 Left 995890819 5:116948425-116948447 CCTACTTCTTTTTCTCGTGCTCT No data
Right 995890821 5:116948465-116948487 TATATGCCTTGTCTGTGCTTGGG No data
995890819_995890820 16 Left 995890819 5:116948425-116948447 CCTACTTCTTTTTCTCGTGCTCT No data
Right 995890820 5:116948464-116948486 TTATATGCCTTGTCTGTGCTTGG No data
995890819_995890822 20 Left 995890819 5:116948425-116948447 CCTACTTCTTTTTCTCGTGCTCT No data
Right 995890822 5:116948468-116948490 ATGCCTTGTCTGTGCTTGGGAGG No data
995890819_995890823 21 Left 995890819 5:116948425-116948447 CCTACTTCTTTTTCTCGTGCTCT No data
Right 995890823 5:116948469-116948491 TGCCTTGTCTGTGCTTGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995890819 Original CRISPR AGAGCACGAGAAAAAGAAGT AGG (reversed) Intergenic