ID: 995890822

View in Genome Browser
Species Human (GRCh38)
Location 5:116948468-116948490
Sequence ATGCCTTGTCTGTGCTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995890819_995890822 20 Left 995890819 5:116948425-116948447 CCTACTTCTTTTTCTCGTGCTCT No data
Right 995890822 5:116948468-116948490 ATGCCTTGTCTGTGCTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995890822 Original CRISPR ATGCCTTGTCTGTGCTTGGG AGG Intergenic