ID: 995896300

View in Genome Browser
Species Human (GRCh38)
Location 5:117015169-117015191
Sequence ATTGAATAGACTAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995896300_995896304 17 Left 995896300 5:117015169-117015191 CCTTCCTCATTAGTCTATTCAAT No data
Right 995896304 5:117015209-117015231 TTTACTTTGATTCTTTCAGATGG No data
995896300_995896305 29 Left 995896300 5:117015169-117015191 CCTTCCTCATTAGTCTATTCAAT No data
Right 995896305 5:117015221-117015243 CTTTCAGATGGTTTCCTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995896300 Original CRISPR ATTGAATAGACTAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr