ID: 995900051

View in Genome Browser
Species Human (GRCh38)
Location 5:117054982-117055004
Sequence GTCCTCCACTTGGCCATGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995900051_995900055 1 Left 995900051 5:117054982-117055004 CCTACCATGGCCAAGTGGAGGAC No data
Right 995900055 5:117055006-117055028 AGTGTTTACTTTAGTATCTGAGG No data
995900051_995900057 27 Left 995900051 5:117054982-117055004 CCTACCATGGCCAAGTGGAGGAC No data
Right 995900057 5:117055032-117055054 TGATTTAAAGCCTGTTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995900051 Original CRISPR GTCCTCCACTTGGCCATGGT AGG (reversed) Intergenic
No off target data available for this crispr