ID: 995900052

View in Genome Browser
Species Human (GRCh38)
Location 5:117054986-117055008
Sequence ACTGGTCCTCCACTTGGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995900052_995900057 23 Left 995900052 5:117054986-117055008 CCATGGCCAAGTGGAGGACCAGT No data
Right 995900057 5:117055032-117055054 TGATTTAAAGCCTGTTTACATGG No data
995900052_995900055 -3 Left 995900052 5:117054986-117055008 CCATGGCCAAGTGGAGGACCAGT No data
Right 995900055 5:117055006-117055028 AGTGTTTACTTTAGTATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995900052 Original CRISPR ACTGGTCCTCCACTTGGCCA TGG (reversed) Intergenic
No off target data available for this crispr