ID: 995900055

View in Genome Browser
Species Human (GRCh38)
Location 5:117055006-117055028
Sequence AGTGTTTACTTTAGTATCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995900050_995900055 2 Left 995900050 5:117054981-117055003 CCCTACCATGGCCAAGTGGAGGA No data
Right 995900055 5:117055006-117055028 AGTGTTTACTTTAGTATCTGAGG No data
995900051_995900055 1 Left 995900051 5:117054982-117055004 CCTACCATGGCCAAGTGGAGGAC No data
Right 995900055 5:117055006-117055028 AGTGTTTACTTTAGTATCTGAGG No data
995900052_995900055 -3 Left 995900052 5:117054986-117055008 CCATGGCCAAGTGGAGGACCAGT No data
Right 995900055 5:117055006-117055028 AGTGTTTACTTTAGTATCTGAGG No data
995900048_995900055 3 Left 995900048 5:117054980-117055002 CCCCTACCATGGCCAAGTGGAGG No data
Right 995900055 5:117055006-117055028 AGTGTTTACTTTAGTATCTGAGG No data
995900053_995900055 -9 Left 995900053 5:117054992-117055014 CCAAGTGGAGGACCAGTGTTTAC No data
Right 995900055 5:117055006-117055028 AGTGTTTACTTTAGTATCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995900055 Original CRISPR AGTGTTTACTTTAGTATCTG AGG Intergenic
No off target data available for this crispr