ID: 995900057

View in Genome Browser
Species Human (GRCh38)
Location 5:117055032-117055054
Sequence TGATTTAAAGCCTGTTTACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995900053_995900057 17 Left 995900053 5:117054992-117055014 CCAAGTGGAGGACCAGTGTTTAC No data
Right 995900057 5:117055032-117055054 TGATTTAAAGCCTGTTTACATGG No data
995900050_995900057 28 Left 995900050 5:117054981-117055003 CCCTACCATGGCCAAGTGGAGGA No data
Right 995900057 5:117055032-117055054 TGATTTAAAGCCTGTTTACATGG No data
995900054_995900057 5 Left 995900054 5:117055004-117055026 CCAGTGTTTACTTTAGTATCTGA No data
Right 995900057 5:117055032-117055054 TGATTTAAAGCCTGTTTACATGG No data
995900051_995900057 27 Left 995900051 5:117054982-117055004 CCTACCATGGCCAAGTGGAGGAC No data
Right 995900057 5:117055032-117055054 TGATTTAAAGCCTGTTTACATGG No data
995900052_995900057 23 Left 995900052 5:117054986-117055008 CCATGGCCAAGTGGAGGACCAGT No data
Right 995900057 5:117055032-117055054 TGATTTAAAGCCTGTTTACATGG No data
995900048_995900057 29 Left 995900048 5:117054980-117055002 CCCCTACCATGGCCAAGTGGAGG No data
Right 995900057 5:117055032-117055054 TGATTTAAAGCCTGTTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995900057 Original CRISPR TGATTTAAAGCCTGTTTACA TGG Intergenic
No off target data available for this crispr