ID: 995904438

View in Genome Browser
Species Human (GRCh38)
Location 5:117106518-117106540
Sequence ATGCATGGAGAGATTGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995904431_995904438 23 Left 995904431 5:117106472-117106494 CCCTGTATATTTGTGAACTCCCT No data
Right 995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG No data
995904436_995904438 3 Left 995904436 5:117106492-117106514 CCTGTTGATGGCTGATTAGGTTG No data
Right 995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG No data
995904432_995904438 22 Left 995904432 5:117106473-117106495 CCTGTATATTTGTGAACTCCCTG No data
Right 995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG No data
995904435_995904438 4 Left 995904435 5:117106491-117106513 CCCTGTTGATGGCTGATTAGGTT No data
Right 995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG No data
995904430_995904438 24 Left 995904430 5:117106471-117106493 CCCCTGTATATTTGTGAACTCCC No data
Right 995904438 5:117106518-117106540 ATGCATGGAGAGATTGAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995904438 Original CRISPR ATGCATGGAGAGATTGAGCA TGG Intergenic
No off target data available for this crispr