ID: 995905993

View in Genome Browser
Species Human (GRCh38)
Location 5:117123802-117123824
Sequence CAAAGTTACCACCATAGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995905993_995905995 6 Left 995905993 5:117123802-117123824 CCTCCACTATGGTGGTAACTTTG No data
Right 995905995 5:117123831-117123853 TTTACCTTGAAATTCACTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995905993 Original CRISPR CAAAGTTACCACCATAGTGG AGG (reversed) Intergenic
No off target data available for this crispr