ID: 995909009

View in Genome Browser
Species Human (GRCh38)
Location 5:117163305-117163327
Sequence CTGTAGAAGCAGAAGTTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995909006_995909009 26 Left 995909006 5:117163256-117163278 CCACTTCACTGGTTAGTTCTGAG No data
Right 995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995909009 Original CRISPR CTGTAGAAGCAGAAGTTTCA TGG Intergenic
No off target data available for this crispr