ID: 995913311

View in Genome Browser
Species Human (GRCh38)
Location 5:117213828-117213850
Sequence ACACCTCATTGGTTGATTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995913306_995913311 1 Left 995913306 5:117213804-117213826 CCAGGTTCTAAGTCCCGAGTAGG No data
Right 995913311 5:117213828-117213850 ACACCTCATTGGTTGATTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995913311 Original CRISPR ACACCTCATTGGTTGATTCT AGG Intergenic