ID: 995914812

View in Genome Browser
Species Human (GRCh38)
Location 5:117232192-117232214
Sequence AAGGCTGCAGGGTAGAACAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995914807_995914812 5 Left 995914807 5:117232164-117232186 CCAAATTAATGACCTAGAAGAGA No data
Right 995914812 5:117232192-117232214 AAGGCTGCAGGGTAGAACAGTGG No data
995914809_995914812 -7 Left 995914809 5:117232176-117232198 CCTAGAAGAGATACAGAAGGCTG No data
Right 995914812 5:117232192-117232214 AAGGCTGCAGGGTAGAACAGTGG No data
995914806_995914812 19 Left 995914806 5:117232150-117232172 CCAAAAAATGCATGCCAAATTAA No data
Right 995914812 5:117232192-117232214 AAGGCTGCAGGGTAGAACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995914812 Original CRISPR AAGGCTGCAGGGTAGAACAG TGG Intergenic
No off target data available for this crispr