ID: 995918705

View in Genome Browser
Species Human (GRCh38)
Location 5:117284142-117284164
Sequence CAGGAGAAGCAGATTGAACA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995918705_995918707 13 Left 995918705 5:117284142-117284164 CCGTGTTCAATCTGCTTCTCCTG No data
Right 995918707 5:117284178-117284200 TTTTTTTTTTTTTTTTTTTATGG 0: 801
1: 21948
2: 23316
3: 134208
4: 141530

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995918705 Original CRISPR CAGGAGAAGCAGATTGAACA CGG (reversed) Intergenic
No off target data available for this crispr