ID: 995919279

View in Genome Browser
Species Human (GRCh38)
Location 5:117291804-117291826
Sequence TTTACATTCTGAGTTGTTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995919279_995919280 2 Left 995919279 5:117291804-117291826 CCAGCAACAACTCAGAATGTAAA No data
Right 995919280 5:117291829-117291851 TATTACAAGTCCTCCTTTTGAGG No data
995919279_995919281 3 Left 995919279 5:117291804-117291826 CCAGCAACAACTCAGAATGTAAA No data
Right 995919281 5:117291830-117291852 ATTACAAGTCCTCCTTTTGAGGG No data
995919279_995919284 28 Left 995919279 5:117291804-117291826 CCAGCAACAACTCAGAATGTAAA No data
Right 995919284 5:117291855-117291877 TTGCATCATTTTCTTTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995919279 Original CRISPR TTTACATTCTGAGTTGTTGC TGG (reversed) Intergenic
No off target data available for this crispr