ID: 995919281

View in Genome Browser
Species Human (GRCh38)
Location 5:117291830-117291852
Sequence ATTACAAGTCCTCCTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995919279_995919281 3 Left 995919279 5:117291804-117291826 CCAGCAACAACTCAGAATGTAAA No data
Right 995919281 5:117291830-117291852 ATTACAAGTCCTCCTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995919281 Original CRISPR ATTACAAGTCCTCCTTTTGA GGG Intergenic
No off target data available for this crispr