ID: 995919284

View in Genome Browser
Species Human (GRCh38)
Location 5:117291855-117291877
Sequence TTGCATCATTTTCTTTAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995919282_995919284 -7 Left 995919282 5:117291839-117291861 CCTCCTTTTGAGGGCTTTGCATC No data
Right 995919284 5:117291855-117291877 TTGCATCATTTTCTTTAAAGAGG No data
995919279_995919284 28 Left 995919279 5:117291804-117291826 CCAGCAACAACTCAGAATGTAAA No data
Right 995919284 5:117291855-117291877 TTGCATCATTTTCTTTAAAGAGG No data
995919283_995919284 -10 Left 995919283 5:117291842-117291864 CCTTTTGAGGGCTTTGCATCATT No data
Right 995919284 5:117291855-117291877 TTGCATCATTTTCTTTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995919284 Original CRISPR TTGCATCATTTTCTTTAAAG AGG Intergenic
No off target data available for this crispr