ID: 995927616

View in Genome Browser
Species Human (GRCh38)
Location 5:117394328-117394350
Sequence AAGGACTCCCAAAGTTATCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995927616_995927620 24 Left 995927616 5:117394328-117394350 CCCTGATAACTTTGGGAGTCCTT No data
Right 995927620 5:117394375-117394397 TTCCCCAAGAATCCTTGCTGTGG No data
995927616_995927623 26 Left 995927616 5:117394328-117394350 CCCTGATAACTTTGGGAGTCCTT No data
Right 995927623 5:117394377-117394399 CCCCAAGAATCCTTGCTGTGGGG No data
995927616_995927625 27 Left 995927616 5:117394328-117394350 CCCTGATAACTTTGGGAGTCCTT No data
Right 995927625 5:117394378-117394400 CCCAAGAATCCTTGCTGTGGGGG No data
995927616_995927621 25 Left 995927616 5:117394328-117394350 CCCTGATAACTTTGGGAGTCCTT No data
Right 995927621 5:117394376-117394398 TCCCCAAGAATCCTTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995927616 Original CRISPR AAGGACTCCCAAAGTTATCA GGG (reversed) Intergenic
No off target data available for this crispr