ID: 995945517

View in Genome Browser
Species Human (GRCh38)
Location 5:117640377-117640399
Sequence CCATGGGCAATCTGAGCAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995945510_995945517 30 Left 995945510 5:117640324-117640346 CCCTCATGAAGTAAATTTGAATG No data
Right 995945517 5:117640377-117640399 CCATGGGCAATCTGAGCAAGAGG No data
995945511_995945517 29 Left 995945511 5:117640325-117640347 CCTCATGAAGTAAATTTGAATGA No data
Right 995945517 5:117640377-117640399 CCATGGGCAATCTGAGCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995945517 Original CRISPR CCATGGGCAATCTGAGCAAG AGG Intergenic
No off target data available for this crispr