ID: 995947970

View in Genome Browser
Species Human (GRCh38)
Location 5:117672906-117672928
Sequence CTTTGGCTGTGAAGGGAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995947970_995947978 21 Left 995947970 5:117672906-117672928 CCCTTTTCCCTTCACAGCCAAAG No data
Right 995947978 5:117672950-117672972 AAGAACATAGGTTCTAGTGGAGG No data
995947970_995947976 9 Left 995947970 5:117672906-117672928 CCCTTTTCCCTTCACAGCCAAAG No data
Right 995947976 5:117672938-117672960 TACATTAAGCTCAAGAACATAGG No data
995947970_995947979 25 Left 995947970 5:117672906-117672928 CCCTTTTCCCTTCACAGCCAAAG No data
Right 995947979 5:117672954-117672976 ACATAGGTTCTAGTGGAGGAAGG No data
995947970_995947981 27 Left 995947970 5:117672906-117672928 CCCTTTTCCCTTCACAGCCAAAG No data
Right 995947981 5:117672956-117672978 ATAGGTTCTAGTGGAGGAAGGGG No data
995947970_995947977 18 Left 995947970 5:117672906-117672928 CCCTTTTCCCTTCACAGCCAAAG No data
Right 995947977 5:117672947-117672969 CTCAAGAACATAGGTTCTAGTGG No data
995947970_995947980 26 Left 995947970 5:117672906-117672928 CCCTTTTCCCTTCACAGCCAAAG No data
Right 995947980 5:117672955-117672977 CATAGGTTCTAGTGGAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995947970 Original CRISPR CTTTGGCTGTGAAGGGAAAA GGG (reversed) Intergenic
No off target data available for this crispr