ID: 995951695

View in Genome Browser
Species Human (GRCh38)
Location 5:117721929-117721951
Sequence TGTCCATGATGCACTGTTAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995951695_995951698 19 Left 995951695 5:117721929-117721951 CCTCTAACAGTGCATCATGGACA 0: 1
1: 0
2: 0
3: 21
4: 103
Right 995951698 5:117721971-117721993 CTTGAACCATGTAATTCCTCTGG 0: 1
1: 0
2: 1
3: 9
4: 104
995951695_995951699 20 Left 995951695 5:117721929-117721951 CCTCTAACAGTGCATCATGGACA 0: 1
1: 0
2: 0
3: 21
4: 103
Right 995951699 5:117721972-117721994 TTGAACCATGTAATTCCTCTGGG 0: 1
1: 0
2: 1
3: 15
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995951695 Original CRISPR TGTCCATGATGCACTGTTAG AGG (reversed) Intergenic
900793851 1:4695878-4695900 TCTCCCTGAGGCTCTGTTAGGGG - Intronic
901982214 1:13045419-13045441 TGTCCATGATGCTCTAATGGTGG + Intronic
903483530 1:23672304-23672326 TATCCATGATTCACTGTAAATGG + Intergenic
903598360 1:24514531-24514553 CGTCCATGAAGCAGTGTTTGAGG + Exonic
904655669 1:32044579-32044601 TGTCCATCATGCACTGCTGCAGG - Intronic
1063573581 10:7240295-7240317 TGTCCAAGATACACTGTGAGTGG - Intronic
1063923547 10:10955359-10955381 AGTCCCTGATGCACAGCTAGAGG - Intergenic
1070826398 10:79392721-79392743 TGTCCATGGAGCAGTGTTAGGGG - Intronic
1075319673 10:121480686-121480708 AATCCATAATGCACTGTTAAAGG + Intronic
1078938395 11:15973285-15973307 TCTCCTTGATGCTATGTTAGGGG + Intronic
1084521358 11:69665005-69665027 TGTCCATACTGCAATGTTGGCGG + Intronic
1089425541 11:118370982-118371004 TCTCCATGTGGCACTGTTGGAGG - Intronic
1094034778 12:26056617-26056639 TGTGGCAGATGCACTGTTAGAGG + Intronic
1095683778 12:45008935-45008957 TGTCCATGATTCATTGTTAAGGG - Intergenic
1099847889 12:88052431-88052453 TGTCCATGATAAACTGTTAAAGG + Intronic
1100857971 12:98775133-98775155 TGTCCAGGAGGCACTGTCACAGG + Intronic
1104608405 12:130206568-130206590 TGTCCCCTATGCACTGTGAGTGG + Intergenic
1106147731 13:27065365-27065387 TTTTCATGATTCCCTGTTAGCGG - Intergenic
1106780480 13:33054246-33054268 TTTCCATGATGAACTTTTTGAGG - Exonic
1111173355 13:84559680-84559702 TGTCCATTTTGCACTATTTGGGG + Intergenic
1114069199 14:19094734-19094756 TGGCTTTGATGCCCTGTTAGGGG + Intergenic
1114093061 14:19305269-19305291 TGGCTTTGATGCCCTGTTAGGGG - Intergenic
1115745901 14:36437269-36437291 TGTCCAGGGTGCATTGTTAAGGG + Intergenic
1117884610 14:60347243-60347265 TGTCCTTGAAGCACTGTTTCTGG + Intergenic
1124158961 15:27252253-27252275 TGTCCATGATGCCCTGTCCGAGG + Intronic
1124250010 15:28100992-28101014 TGTCCCTGAGGCACTGGGAGGGG - Intergenic
1125731571 15:41895180-41895202 TGTCCAGGATGCCGAGTTAGGGG - Intergenic
1125856248 15:42952618-42952640 TTTCCATGAAGCCCTTTTAGGGG - Intronic
1125898689 15:43325504-43325526 TGAGCATGATGCTCAGTTAGAGG + Exonic
1126946690 15:53829509-53829531 TGTCCATGGTGCACTGTGTCAGG + Intergenic
1132459643 16:45212-45234 TGGCCATGATGCCCTGCGAGAGG + Intergenic
1138369439 16:56514515-56514537 TGGCTATGATGCCCTTTTAGTGG - Exonic
1140826454 16:78711208-78711230 TTTCCATGATGCACACTTAGAGG - Intronic
1143592701 17:7895136-7895158 TGTCCCCGATGCACAGTGAGTGG + Exonic
1143943632 17:10569696-10569718 TGTCCAGGATACATTGTTAAGGG + Intergenic
1144796817 17:17897045-17897067 TGTCCATCATGCCCTGCTAGAGG + Intronic
1146937688 17:36822603-36822625 TGTCCATGATATAGTGTTAAAGG + Intergenic
1149611629 17:57961536-57961558 TGTTCATGATACAATGTTGGGGG + Intergenic
1150065600 17:62106340-62106362 TGACCCTGCTGCACTGTTAAAGG - Intergenic
1154052200 18:10971580-10971602 TCCCCATGATGCACTCGTAGGGG + Intronic
1156743632 18:40363294-40363316 TTTCCATAATGCACAGTTAGTGG + Intergenic
1160375927 18:78411673-78411695 TGTCCAGGATGCACAGTGACTGG - Intergenic
1164609783 19:29624187-29624209 TGTCCCTGAGGCCCTGTTCGTGG - Intergenic
1164707803 19:30333232-30333254 TGACCATGAGGCCCTGGTAGAGG + Intronic
926698055 2:15784488-15784510 TGTCCACCCTGCACTGTTATGGG + Intergenic
927242440 2:20930664-20930686 TGTCCAAAATGCAATGTCAGGGG - Intergenic
931848659 2:66231030-66231052 TTTCCAAGATGCCCTGTTTGTGG + Intergenic
933751609 2:85605817-85605839 TCTCCATGGTGCACTCTGAGGGG - Intronic
937980265 2:127610606-127610628 TTTCCATGCTGTAATGTTAGTGG + Intronic
939243783 2:139596533-139596555 TGTACATCATGCACTGTTGATGG - Intergenic
944704818 2:202278116-202278138 TGTCAATGATGCATTCTTATTGG + Intronic
946634574 2:221710415-221710437 TGTCCATAATGCACAATTAGAGG - Intergenic
1170067973 20:12335097-12335119 TGCCCATGATGTAGTGTTATGGG + Intergenic
1175048455 20:56129548-56129570 TGTCCATGATACAGGGTTAGGGG + Intergenic
1175362450 20:58423675-58423697 TATCCATCAAGCACTGATAGTGG + Intronic
1176900345 21:14434066-14434088 TTTCCATACTGCACTGTTGGAGG - Intergenic
1178976729 21:37226992-37227014 TGTTCATGATACAATGTTAAGGG + Intronic
1179709287 21:43203698-43203720 TGTGAAAGCTGCACTGTTAGGGG - Intergenic
1180487672 22:15817297-15817319 TGGCTTTGATGCCCTGTTAGGGG + Intergenic
1183183578 22:36278194-36278216 TGTCCATGAGACACTGCTAGTGG - Intergenic
949701138 3:6760589-6760611 TGTCCACGATGAAATGTTAAGGG - Intergenic
949971296 3:9407452-9407474 TGTTCATGATAAACTGTAAGAGG - Intronic
956655409 3:71545894-71545916 TGCCCATGGTTCACTGGTAGAGG - Intronic
956657330 3:71565181-71565203 TGTCCATAGTGGAGTGTTAGGGG + Intronic
963008123 3:140745250-140745272 TGTGTATGAGGCACTGTGAGGGG + Intergenic
964248335 3:154681428-154681450 TGTCCAAGGTACACTGTTTGGGG + Intergenic
965260329 3:166474622-166474644 TTTCCATGATTTACTGTCAGTGG + Intergenic
965780404 3:172279735-172279757 TGACTATGATCCACAGTTAGTGG - Intronic
970363321 4:15332557-15332579 TGGCCATGATTCACTATTTGTGG - Intergenic
973716528 4:53682282-53682304 TCTCCATGAGCCCCTGTTAGAGG + Intronic
974274433 4:59699527-59699549 AGTCCATGAACCACTGTTTGGGG - Intergenic
976275192 4:83269463-83269485 TGTCCATGTCACACAGTTAGTGG - Intronic
979281298 4:118871140-118871162 TGGTGTTGATGCACTGTTAGGGG - Intronic
979477125 4:121171484-121171506 TGTTCATGATAAAATGTTAGGGG + Intronic
979815166 4:125091942-125091964 TGTCCATCATACAGTGTTTGAGG - Intergenic
981687768 4:147474232-147474254 TTTCCATGATGTTTTGTTAGTGG + Intergenic
982250255 4:153399063-153399085 TTTTCATGATGAACTGCTAGAGG - Intronic
986812936 5:11379330-11379352 TGTACGTGATGCATAGTTAGAGG - Intronic
987026464 5:13931879-13931901 AGTCCGTGATGCATTGTTAAGGG - Intronic
988083686 5:26445329-26445351 GGTCCATGAAGCATTCTTAGAGG + Intergenic
989112882 5:37924440-37924462 TGTCCATCATGCACAGGTCGGGG - Intergenic
990321720 5:54636173-54636195 TTTCCATGATGCTCAGTCAGGGG + Intergenic
994669522 5:102750092-102750114 TGTTCATCATGCAGTGATAGAGG + Intergenic
995357391 5:111254723-111254745 TGTGCATGATGCATTGATGGGGG - Intronic
995951695 5:117721929-117721951 TGTCCATGATGCACTGTTAGAGG - Intergenic
997101847 5:130978560-130978582 TGTCCCTGAGTCACTGTTAAAGG - Intergenic
999641152 5:153674490-153674512 TGTCCATGAAGCCCTGTGAGAGG - Exonic
1003121835 6:3324397-3324419 TGTCCATGATGCTGTATTAGGGG + Intronic
1004351329 6:14892882-14892904 TCCCCATGAGGCACAGTTAGAGG - Intergenic
1004642660 6:17530546-17530568 TGTCCATGAAGGACAGTTCGAGG + Intronic
1010949853 6:82022848-82022870 TGCCCCTTATACACTGTTAGAGG - Intergenic
1014076220 6:117237770-117237792 TGTCCATGACTCACTCTTTGTGG - Intergenic
1015735269 6:136392736-136392758 TGACCATCATACACTGTTGGTGG - Intronic
1015870329 6:137769712-137769734 TGTCCAAGGTGCAGAGTTAGAGG - Intergenic
1016968683 6:149742487-149742509 TGTACATGGTGCACTGCTATAGG + Exonic
1020017916 7:4842295-4842317 TGTCCCTGAAGCTCTGTTAGCGG + Intronic
1020942265 7:14555545-14555567 TGTCCATGAAGGAATGTCAGAGG + Intronic
1022789031 7:33668501-33668523 TGTCCATGATTTACAGTGAGGGG + Intergenic
1024925888 7:54615182-54615204 TGTGCATTATGAACTATTAGAGG + Intergenic
1026671581 7:72395529-72395551 TGACCATGAAGCACCTTTAGAGG + Intronic
1030204947 7:106943577-106943599 TGTCCAAGATGTATTGTTAGTGG + Intergenic
1031457773 7:122004758-122004780 TGTGTATGATTCACTGTTTGTGG + Intronic
1033550473 7:142442540-142442562 TGCCGATGATACACTGATAGGGG - Intergenic
1039828032 8:41191482-41191504 TGTCCATCATGGCATGTTAGAGG - Intergenic
1041718637 8:60955653-60955675 GGTCCATGATATTCTGTTAGAGG + Intergenic
1046749550 8:117912687-117912709 TGTAGATGATTCACTATTAGGGG - Intronic
1048671413 8:136727308-136727330 TGTCAATAATACACTGTTGGTGG - Intergenic
1054941499 9:70747779-70747801 TGTGTAGGATGCATTGTTAGGGG + Intronic
1056233765 9:84571746-84571768 TTTCCATGAAGCAATGGTAGCGG - Intergenic
1056712535 9:89002277-89002299 TGTCCATGATGCAGGATGAGGGG - Exonic
1056972906 9:91223234-91223256 AGTCCTGGATGCAGTGTTAGTGG - Intronic
1060093388 9:120764750-120764772 AGTCCATGATGTACAGGTAGCGG + Exonic
1186163687 X:6804766-6804788 TGTGCATGCAGTACTGTTAGAGG + Intergenic
1186868515 X:13746025-13746047 TGTTCATCATGAAATGTTAGAGG - Intronic
1186881442 X:13870617-13870639 TCTCCCTGAAGCAGTGTTAGGGG - Intronic
1188309913 X:28603822-28603844 TGTTCATGATGCAATGTTACTGG + Intronic
1189151005 X:38706523-38706545 TTTCCATGATTCACTGTGATGGG + Intergenic
1189190288 X:39095667-39095689 GATCCCTTATGCACTGTTAGTGG + Intergenic
1190948009 X:55114788-55114810 TGTCCAAGATGCACTGTGAAAGG + Intronic
1195822466 X:108961204-108961226 TGTCCATTAAGGACTGTTAGAGG - Intergenic
1196458788 X:115908729-115908751 TGTCCATCATGCAGTGTTAAGGG + Intergenic
1196462771 X:115947156-115947178 TGTCCATCATGCAGTGTTAAGGG + Intergenic
1197709883 X:129658121-129658143 TGTTCCTGATGCACTGTGAGAGG - Intergenic
1198141536 X:133808835-133808857 TGTGCATTATGCATTGTTTGTGG - Intronic
1202071168 Y:20993037-20993059 TGTCAGTGATGCACTGCAAGAGG + Intergenic