ID: 995952164

View in Genome Browser
Species Human (GRCh38)
Location 5:117729345-117729367
Sequence CAACCTGCTCAAATTTAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995952164 Original CRISPR CAACCTGCTCAAATTTAGAT CGG (reversed) Intergenic
No off target data available for this crispr