ID: 995952777

View in Genome Browser
Species Human (GRCh38)
Location 5:117736757-117736779
Sequence GTGTTGTTTTCATTTTACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995952773_995952777 -6 Left 995952773 5:117736740-117736762 CCCCTTTCCAGGACACAGTGTTG No data
Right 995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG No data
995952772_995952777 3 Left 995952772 5:117736731-117736753 CCATCTCTTCCCCTTTCCAGGAC No data
Right 995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG No data
995952770_995952777 7 Left 995952770 5:117736727-117736749 CCATCCATCTCTTCCCCTTTCCA No data
Right 995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG No data
995952769_995952777 8 Left 995952769 5:117736726-117736748 CCCATCCATCTCTTCCCCTTTCC No data
Right 995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG No data
995952775_995952777 -8 Left 995952775 5:117736742-117736764 CCTTTCCAGGACACAGTGTTGTT No data
Right 995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG No data
995952774_995952777 -7 Left 995952774 5:117736741-117736763 CCCTTTCCAGGACACAGTGTTGT No data
Right 995952777 5:117736757-117736779 GTGTTGTTTTCATTTTACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995952777 Original CRISPR GTGTTGTTTTCATTTTACCC AGG Intergenic
No off target data available for this crispr