ID: 995953469

View in Genome Browser
Species Human (GRCh38)
Location 5:117745450-117745472
Sequence CCACCATACAAGTGTAAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995953465_995953469 12 Left 995953465 5:117745415-117745437 CCCAAGTATTTTAAACATGCAGC No data
Right 995953469 5:117745450-117745472 CCACCATACAAGTGTAAAATAGG No data
995953467_995953469 -10 Left 995953467 5:117745437-117745459 CCAAAATTGAGAACCACCATACA No data
Right 995953469 5:117745450-117745472 CCACCATACAAGTGTAAAATAGG No data
995953466_995953469 11 Left 995953466 5:117745416-117745438 CCAAGTATTTTAAACATGCAGCC No data
Right 995953469 5:117745450-117745472 CCACCATACAAGTGTAAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995953469 Original CRISPR CCACCATACAAGTGTAAAAT AGG Intergenic
No off target data available for this crispr