ID: 995956430

View in Genome Browser
Species Human (GRCh38)
Location 5:117782479-117782501
Sequence TCCACACAGATTGTATTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995956430_995956433 2 Left 995956430 5:117782479-117782501 CCTGGGAATACAATCTGTGTGGA No data
Right 995956433 5:117782504-117782526 CGGTCTGAAGATTTCCCAAAGGG No data
995956430_995956434 3 Left 995956430 5:117782479-117782501 CCTGGGAATACAATCTGTGTGGA No data
Right 995956434 5:117782505-117782527 GGTCTGAAGATTTCCCAAAGGGG No data
995956430_995956432 1 Left 995956430 5:117782479-117782501 CCTGGGAATACAATCTGTGTGGA No data
Right 995956432 5:117782503-117782525 ACGGTCTGAAGATTTCCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995956430 Original CRISPR TCCACACAGATTGTATTCCC AGG (reversed) Intergenic
No off target data available for this crispr