ID: 995963754

View in Genome Browser
Species Human (GRCh38)
Location 5:117878438-117878460
Sequence GTGTACTAGCTGTATGAACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995963753_995963754 30 Left 995963753 5:117878385-117878407 CCTGAACACAGAATTGGACAATT No data
Right 995963754 5:117878438-117878460 GTGTACTAGCTGTATGAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995963754 Original CRISPR GTGTACTAGCTGTATGAACA TGG Intergenic
No off target data available for this crispr