ID: 995964004

View in Genome Browser
Species Human (GRCh38)
Location 5:117882148-117882170
Sequence TGGACTGGAGCTGCCTGTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995964004_995964007 -2 Left 995964004 5:117882148-117882170 CCAGTACAGGCAGCTCCAGTCCA No data
Right 995964007 5:117882169-117882191 CAAAACACCTCAGAGATTCCTGG No data
995964004_995964011 27 Left 995964004 5:117882148-117882170 CCAGTACAGGCAGCTCCAGTCCA No data
Right 995964011 5:117882198-117882220 TAGACAATTTTTTAAATCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995964004 Original CRISPR TGGACTGGAGCTGCCTGTAC TGG (reversed) Intergenic
No off target data available for this crispr