ID: 995965541

View in Genome Browser
Species Human (GRCh38)
Location 5:117903137-117903159
Sequence GGGGGTGGGGGGGCGTTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995965527_995965541 27 Left 995965527 5:117903087-117903109 CCTCTCTGGTAGAACATCAAACA No data
Right 995965541 5:117903137-117903159 GGGGGTGGGGGGGCGTTCAGAGG No data
995965533_995965541 -7 Left 995965533 5:117903121-117903143 CCATTTATCCAGTACTGGGGGTG No data
Right 995965541 5:117903137-117903159 GGGGGTGGGGGGGCGTTCAGAGG No data
995965532_995965541 -6 Left 995965532 5:117903120-117903142 CCCATTTATCCAGTACTGGGGGT No data
Right 995965541 5:117903137-117903159 GGGGGTGGGGGGGCGTTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995965541 Original CRISPR GGGGGTGGGGGGGCGTTCAG AGG Intergenic