ID: 995971296

View in Genome Browser
Species Human (GRCh38)
Location 5:117974257-117974279
Sequence ATATGCTGTTAGAAGTGGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995971292_995971296 28 Left 995971292 5:117974206-117974228 CCGTTTTAAATATAAGTTCTAAC No data
Right 995971296 5:117974257-117974279 ATATGCTGTTAGAAGTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995971296 Original CRISPR ATATGCTGTTAGAAGTGGCC AGG Intergenic
No off target data available for this crispr