ID: 995971982

View in Genome Browser
Species Human (GRCh38)
Location 5:117983713-117983735
Sequence TTGGAGATACAGCAGGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995971982_995971988 7 Left 995971982 5:117983713-117983735 CCCTGCCCCTGCTGTATCTCCAA No data
Right 995971988 5:117983743-117983765 AACTCAGCCTAACACAAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995971982 Original CRISPR TTGGAGATACAGCAGGGGCA GGG (reversed) Intergenic
No off target data available for this crispr