ID: 995976454

View in Genome Browser
Species Human (GRCh38)
Location 5:118041867-118041889
Sequence GTGAAAAAAATGAAGACTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995976452_995976454 1 Left 995976452 5:118041843-118041865 CCAAAGGAGGTGTGTGAGTTTCC No data
Right 995976454 5:118041867-118041889 GTGAAAAAAATGAAGACTATAGG No data
995976449_995976454 25 Left 995976449 5:118041819-118041841 CCTTGGTATCAACTATGAGTTAG No data
Right 995976454 5:118041867-118041889 GTGAAAAAAATGAAGACTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995976454 Original CRISPR GTGAAAAAAATGAAGACTAT AGG Intergenic
No off target data available for this crispr