ID: 995981645

View in Genome Browser
Species Human (GRCh38)
Location 5:118111735-118111757
Sequence CTGGCACTGACCTCCTTCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995981645_995981647 -1 Left 995981645 5:118111735-118111757 CCAGGGAAGGAGGTCAGTGCCAG No data
Right 995981647 5:118111757-118111779 GAAAATGTAAGTCACTCCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995981645 Original CRISPR CTGGCACTGACCTCCTTCCC TGG (reversed) Intergenic
No off target data available for this crispr