ID: 995984791

View in Genome Browser
Species Human (GRCh38)
Location 5:118157005-118157027
Sequence CTGAATAAGTATCTGGAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
995984785_995984791 7 Left 995984785 5:118156975-118156997 CCCCAGGCCTGCAGAGATTGGGC No data
Right 995984791 5:118157005-118157027 CTGAATAAGTATCTGGAGTCAGG No data
995984786_995984791 6 Left 995984786 5:118156976-118156998 CCCAGGCCTGCAGAGATTGGGCA No data
Right 995984791 5:118157005-118157027 CTGAATAAGTATCTGGAGTCAGG No data
995984787_995984791 5 Left 995984787 5:118156977-118156999 CCAGGCCTGCAGAGATTGGGCAG No data
Right 995984791 5:118157005-118157027 CTGAATAAGTATCTGGAGTCAGG No data
995984789_995984791 0 Left 995984789 5:118156982-118157004 CCTGCAGAGATTGGGCAGGTGAG No data
Right 995984791 5:118157005-118157027 CTGAATAAGTATCTGGAGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
995984791 Original CRISPR CTGAATAAGTATCTGGAGTC AGG Intergenic
No off target data available for this crispr